分離済み変異体

tm2679

Allele Nametm2679
BalanceNot Required
OutCrossNot Accepted
Sequence NameC10F3.4
Gene Namemcp-1
Worm BaseAllele Name tm2679
Gene Name mcp-1
Sequence C10F3.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7502/7503-7946/7947 (444 bp deletion)
ChromosomeV
Putative gene structurejoin(4436..4504, 5966..6112, 6786..6899, 7068..7175, 7228..7527, 7575..7690, 7776..7856, 7900..8054, 8178..8266, 8320..8397, 8455..8574)
Map position-0.64
Balancer
Map position of balancer
Sequence of primersExtFwd:TGCGACACGGATCCTATCAG,ExtRev:CGGGTTCTGACACAAGCCAA,IntFwd:GACCGTCATTTAGTAGCTGT,IntRev:CAGCGCTTCTCAGAACGAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Schulz A, Sekine Y, Oyeyemi MJ, Abrams AJ, Basavaraju M, Han SM, Groth M, Morrison H, Strittmatter SM, Hammarlund M.
The stress-responsive gene GDPGP1/mcp-1 regulates neuronal glycogen metabolism and survival.
J Cell Biol 2020 219(2)  
[ PubMed ID = 31968056 ] [ RRC reference ]

Patananan AN, Budenholzer LM, Pedraza ME, Torres ER, Adler LN, Clarke SG.
The invertebrate Caenorhabditis elegans biosynthesizes ascorbate.
Arch Biochem Biophys 2015 569 32-44 
[ PubMed ID = 25668719 ] [ RRC reference ]

Adler LN, Gomez TA, Clarke SG, Linster CL.
A novel GDP-D-glucose phosphorylase involved in quality control of the nucleoside diphosphate sugar pool in Caenorhabditis elegans and mammals.
J Biol Chem 2011 286(24) 21511-23 
[ PubMed ID = 21507950 ] [ RRC reference ]

Khare S, Gomez T, Linster CL, Clarke SG.
Defective responses to oxidative stress in protein l-isoaspartyl repair-deficient Caenorhabditis elegans.
Mech Ageing Dev 2009 130(10) 670-80 
[ PubMed ID = 19682488 ] [ RRC reference ]