| Allele Name | tm2679 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C10F3.4 |
| Gene Name | mcp-1 |
| Worm Base | Allele Name |
tm2679
|
| Gene Name |
mcp-1
|
| Sequence |
C10F3.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 7502/7503-7946/7947 (444 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(4436..4504, 5966..6112, 6786..6899, 7068..7175, 7228..7527, 7575..7690, 7776..7856, 7900..8054, 8178..8266, 8320..8397, 8455..8574) |
| Map position | -0.64 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TGCGACACGGATCCTATCAG,ExtRev:CGGGTTCTGACACAAGCCAA,IntFwd:GACCGTCATTTAGTAGCTGT,IntRev:CAGCGCTTCTCAGAACGAGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Schulz A, Sekine Y, Oyeyemi MJ, Abrams AJ, Basavaraju M, Han SM, Groth M, Morrison H, Strittmatter SM, Hammarlund M.
The stress-responsive gene GDPGP1/mcp-1 regulates neuronal glycogen metabolism and survival.
J Cell Biol 2020 219(2)
[ PubMed ID = 31968056 ]
[ RRC reference ]
|
Patananan AN, Budenholzer LM, Pedraza ME, Torres ER, Adler LN, Clarke SG.
The invertebrate Caenorhabditis elegans biosynthesizes ascorbate.
Arch Biochem Biophys 2015 569 32-44
[ PubMed ID = 25668719 ]
[ RRC reference ]
|
Adler LN, Gomez TA, Clarke SG, Linster CL.
A novel GDP-D-glucose phosphorylase involved in quality control of the nucleoside diphosphate sugar pool in Caenorhabditis elegans and mammals.
J Biol Chem 2011 286(24) 21511-23
[ PubMed ID = 21507950 ]
[ RRC reference ]
|
Khare S, Gomez T, Linster CL, Clarke SG.
Defective responses to oxidative stress in protein l-isoaspartyl repair-deficient Caenorhabditis elegans.
Mech Ageing Dev 2009 130(10) 670-80
[ PubMed ID = 19682488 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.