| Allele Name | tm2673 |
| Allele Type | 通常株 |
| Sequence Name | F46G10.7 |
| Gene Name | sir-2.2 |
| Worm Base | Allele Name |
tm2673
|
| Gene Name |
sir-2.2
|
| Sequence |
F46G10.7
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. C-S. Chen: normal sensitivity to Bacillus pore-forming toxin. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 21539/21540-22087/22088 (548 bp deletion) |
| Chromosome | X |
| Putative gene structure | join(21078..21204, 21254..21356, 21574..21714, 21758..21838, 22298..22412, 22459..22641, 22803..22916) |
| Map position | 11.32 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AACAGTGGACAAGCTGCTTG,IntRev:GATTGTCTGCCATTCCACAC,IntFwd:CTTGTCATCTCTGGAGCAGG,ExtRev:GCGTCCATACTCTCTTAGAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Wirth M, Karaca S, Wenzel D, Ho L, Tishkoff D, Lombard DB, Verdin E, Urlaub H, Jedrusik-Bode M, Fischle W.
Mitochondrial SIRT4-type proteins in Caenorhabditis elegans and mammals interact with pyruvate carboxylase and other acetylated biotin-dependent carboxylases.
Mitochondrion 2013 13(6) 705-20
[ PubMed ID = 23438705 ]
[ RRC reference ]
|
Wang W, McReynolds MR, Goncalves JF, Shu M, Dhondt I, Braeckman BP, Lange SE, Kho K, Detwiler AC, Pacella MJ, Hanna-Rose W.
Comparative Metabolomic Profiling Reveals That Dysregulated Glycolysis Stemming from Lack of Salvage NAD+ Biosynthesis Impairs Reproductive Development in Caenorhabditis elegans.
J Biol Chem 2015 290(43) 26163-79
[ PubMed ID = 26350462 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.