分離済み変異体

tm2658

Allele Nametm2658
BalanceNot Required
OutCrossNot Accepted
Sequence NameF55F3.1
Gene Nameaakb-1
Worm BaseAllele Name tm2658
Gene Name aakb-1
Sequence F55F3.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9032/9033-9178/9179 (146 bp deletion)
ChromosomeX
Putative gene structurejoin(7614..7812, 8687..8754, 8885..9113, 10188..10858)
Map position14.75
Balancer
Map position of balancer
Sequence of primersExtFwd:CCCGGTAGTATTCAAGTGGA,ExtRev:AGGATGCTTGGAAGCACTGT,IntFwd:CCAGAACCCCTCGACAAGTA,IntRev:CTTCCGTACAGAATACCGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ju S, Chen H, Wang S, Lin J, Ma Y, Aroian RV, Peng D, Sun M.
C. elegans monitor energy status via the AMPK pathway to trigger innate immune responses against bacterial pathogens.
Commun Biol 2022 5(1) 643 
[ PubMed ID = 35773333 ] [ RRC reference ]

Tullet JM, Araiz C, Sanders MJ, Au C, Benedetto A, Papatheodorou I, Clark E, Schmeisser K, Jones D, Schuster EF, Thornton JM, Gems D.
DAF-16/FoxO directly regulates an atypical AMP-activated protein kinase gamma isoform to mediate the effects of insulin/IGF-1 signaling on aging in Caenorhabditis elegans.
PLoS Genet 2014 10(2) e1004109 
[ PubMed ID = 24516399 ] [ RRC reference ]

Nukazuka A, Tamaki S, Matsumoto K, Oda Y, Fujisawa H, Takagi S.
A shift of the TOR adaptor from Rictor towards Raptor by semaphorin in C. elegans.
Nat Commun 2011 2 484 
[ PubMed ID = 21952218 ] [ RRC reference ]

Narbonne P, Hyenne V, Li S, Labbé JC, Roy R.
Differential requirements for STRAD in LKB1-dependent functions in C. elegans.
Development 2010 137(4) 661-70 
[ PubMed ID = 20110331 ] [ RRC reference ]

Narbonne P, Roy R.
Caenorhabditis elegans dauers need LKB1/AMPK to ration lipid reserves and ensure long-term survival.
Nature 2009 457(7226) 210-4 
[ PubMed ID = 19052547 ] [ RRC reference ]