| Allele Name | tm2657 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | D1007.7 |
| Gene Name | nrd-1 |
| Worm Base | Allele Name |
tm2657
|
| Gene Name |
nrd-1
|
| Sequence |
D1007.7
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. M. Han: fertile, wild-type growth and normal vulval development. Dr. T. Blumenthal: brood size normal and no embryo lethality. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 43452/43453-43832/43833 (380 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(40740..40921, 40977..41071, 41562..42013, 42333..42467, 42529..43067, 43334..43956, 44026..44545, 44592..44850, 44920..45081)) |
| Map position | -1.04 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:GGGATCACCATGGAGACGGA,IntRev:TCAGTGCAAGCCAGATCAAC,ExtFwd:CTAACAGGTGGCAATCCCAT,IntFwd:CCTTAATCGAGCTCGTTCCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979
[ PubMed ID = 29367452 ]
[ RRC reference ]
|
Chen F, Zhou Y, Qi YB, Khivansara V, Li H, Chun SY, Kim JK, Fu XD, Jin Y.
Context-dependent modulation of Pol II CTD phosphatase SSUP-72 regulates alternative polyadenylation in neuronal development.
Genes Dev 2015 29(22) 2377-90
[ PubMed ID = 26588990 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.