分離済み変異体

tm2647

Allele Nametm2647
BalanceNot Required
OutCrossNot Accepted
Sequence NameF16D3.7
Gene Nameser-5
Worm BaseAllele Name tm2647
Gene Name ser-5
Sequence F16D3.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Ashrafi: increased Nile Red staining.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [T19A6] 611/612-[T19A6] 830/831 (219 bp deletion)
ChromosomeI
Putative gene structurejoin(32458..32583, AL021571.1:140..457, AL021571.1:503..676, AL021571.1:729..1661)
Map position2.77
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTGGGATAAGTACGGGCAA,IntFwd:GCTTCGAATAATTCTCCGTG,ExtRev:GCCTCCTTTTGGATCGAACT,IntRev:CAAACGATCGGTGCCTTGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Feng L, Marquina-Solis J, Yue L, Harnagel A, Greenfeld Y, Bargmann CI.
Context-dependent serotonin signaling links dietary quality to foraging decisions.
Nat Commun 2025 16(1) 10479 
[ PubMed ID = 41290599 ] [ RRC reference ]

Dag U, Nwabudike I, Kang D, Gomes MA, Kim J, Atanas AA, Bueno E, Estrem C, Pugliese S, Wang Z, Towlson E, Flavell SW.
Dissecting the functional organization of the C. elegans serotonergic system at whole-brain scale.
Cell 2023 186(12) 2574-2592.e20 
[ PubMed ID = 37192620 ] [ RRC reference ]

Dag U, Nwabudike I, Kang D, Gomes MA, Kim J, Atanas AA, Bueno E, Estrem C, Pugliese S, Wang Z, Towlson E, Flavell SW.
Dissecting the Functional Organization of the C. elegans Serotonergic System at Whole-Brain Scale.
bioRxiv 2023   
[ PubMed ID = 36711891 ] [ RRC reference ]

Stern S, Kirst C, Bargmann CI.
Neuromodulatory Control of Long-Term Behavioral Patterns and Individuality across Development.
Cell 2017 171(7) 1649-1662.e10 
[ PubMed ID = 29198526 ] [ RRC reference ]

Churgin MA, McCloskey RJ, Peters E, Fang-Yen C.
Antagonistic Serotonergic and Octopaminergic Neural Circuits Mediate Food-Dependent Locomotory Behavior in Caenorhabditis elegans.
J Neurosci 2017 37(33) 7811-7823 
[ PubMed ID = 28698386 ] [ RRC reference ]

Rangaraju S, Solis GM, Thompson RC, Gomez-Amaro RL, Kurian L, Encalada SE, Niculescu AB 3rd, Salomon DR, Petrascheck M.
Suppression of transcriptional drift extends C. elegans lifespan by postponing the onset of mortality.
Elife 2015 4 e08833 
[ PubMed ID = 26623667 ] [ RRC reference ]

Guo M, Wu TH, Song YX, Ge MH, Su CM, Niu WP, Li LL, Xu ZJ, Ge CL, Al-Mhanawi MT, Wu SP, Wu ZX.
Reciprocal inhibition between sensory ASH and ASI neurons modulates nociception and avoidance in Caenorhabditis elegans.
Nat Commun 2015 6 5655 
[ PubMed ID = 25585042 ] [ RRC reference ]

Harris G, Korchnak A, Summers P, Hapiak V, Law WJ, Stein AM, Komuniecki P, Komuniecki R.
Dissecting the serotonergic food signal stimulating sensory-mediated aversive behavior in C. elegans.
PLoS One 2011 6(7) e21897 
[ PubMed ID = 21814562 ] [ RRC reference ]

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J Neurosci 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]

Govorunova EG, Moussaif M, Kullyev A, Nguyen KC, McDonald TV, Hall DH, Sze JY.
A homolog of FHM2 is involved in modulation of excitatory neurotransmission by serotonin in C. elegans.
PLoS One 2010 5(4) e10368 
[ PubMed ID = 20442779 ] [ RRC reference ]

Harris GP, Hapiak VM, Wragg RT, Miller SB, Hughes LJ, Hobson RJ, Steven R, Bamber B, Komuniecki RW.
Three distinct amine receptors operating at different levels within the locomotory circuit are each essential for the serotonergic modulation of chemosensation in Caenorhabditis elegans.
J Neurosci 2009 29(5) 1446-56 
[ PubMed ID = 19193891 ] [ RRC reference ]

Hapiak VM, Hobson RJ, Hughes L, Smith K, Harris G, Condon C, Komuniecki P, Komuniecki RW.
Dual excitatory and inhibitory serotonergic inputs modulate egg laying in Caenorhabditis elegans.
Genetics 2009 181(1) 153-63 
[ PubMed ID = 19001289 ] [ RRC reference ]