Allele Name | tm2645 |
Allele Type | バランス済 |
Sequence Name | T24H10.6 |
Gene Name | dyrb-1 |
Worm Base | Allele Name |
tm2645
|
Gene Name |
dyrb-1
|
Sequence |
T24H10.6
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile. Dr. B.A. Bowerman: Dpy, Egl, Pvl, 85% Emb, Dr. M. Gotta: J Cell Biol 179, 15 (2007). |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 8769/8770-9523/9524 (754 bp deletion) |
Chromosome | II |
Putative gene structure | complement(join(9324..9532, 9767..9845)) |
Map position | 1.04 |
Balancer | mIn1 [e128 mIs14] |
Map position of balancer | |
Sequence of primers | IntFwd:CCAACGCAACGGAAGCTAAG,ExtFwd:GGCGTACGGTAGTACTATAC,IntRev:ACGAGCACTTCAGATGTAAG,ExtRev:CTATCGGATTCGATGGCGTC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Feldman JL, Priess JR. A role for the centrosome and PAR-3 in the hand-off of MTOC function during epithelial polarization. Curr Biol 2012 22(7) 575-82
[ PubMed ID = 22425160 ]
[ RRC reference ]
|
O'Rourke SM, Dorfman MD, Carter JC, Bowerman B. Dynein modifiers in C. elegans: light chains suppress conditional heavy chain mutants. PLoS Genet 2007 3(8) e128
[ PubMed ID = 17676955 ]
[ RRC reference ]
|
Couwenbergs C, Labbé JC, Goulding M, Marty T, Bowerman B, Gotta M. Heterotrimeric G protein signaling functions with dynein to promote spindle positioning in C. elegans. J Cell Biol 2007 179(1) 15-22
[ PubMed ID = 17908918 ]
[ RRC reference ]
|
|