Home > 分離済み変異体 > tm2644

分離済み変異体

Allele Name		tm2644
Balance		Not Required
OutCross		Not Accepted
Sequence Name		F56A3.2
Gene Name		giyd-1
Worm Base	Allele Name	tm2644
	Gene Name	giyd-1
	Sequence	F56A3.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		14117/14118-14322/14323 (205 bp deletion)
Chromosome		I
Putative gene structure		join(11707..11819, 11865..12243, 13559..13737, 13798..13941, 14271..14346, 14404..14559, 14614..14805, 15019..15111)
Map position		-0.31
Balancer
Map position of balancer
Sequence of primers		ExtFwd:AGCGTTTACTCCTCGCGGAA,IntFwd:CCGCAAGGATTATACAAGCT,ExtRev:GGGTAGTACACAATCTGCGT,IntRev:ACATGTTGGGCAATTGGCTT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Rieckher M, Gallrein C, Alquezar-Artieda N, Bourached-Silva N, Vaddavalli PL, Mares D, Backhaus M, Blindauer T, Greger K, Wiesner E, Pontel LB, Schumacher B. Distinct DNA repair mechanisms prevent formaldehyde toxicity during development, reproduction and aging. Nucleic Acids Res 2024 52(14) 8271-8285  [ PubMed ID = 38894680 ] [ RRC reference ] Loose JA, Amrit FRG, Patil T, Yanowitz JL, Ghazi A. Meiotic dysfunction accelerates somatic aging in Caenorhabditis elegans. Aging Cell 2022 21(11) e13716  [ PubMed ID = 36176234 ] [ RRC reference ] Ujisawa T, Ohta A, Ii T, Minakuchi Y, Toyoda A, Ii M, Kuhara A. Endoribonuclease ENDU-2 regulates multiple traits including cold tolerance via cell autonomous and nonautonomous controls in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2018 115(35) 8823-8828  [ PubMed ID = 30104389 ] [ RRC reference ] Saito TT, Colaiácovo MP. Regulation of Crossover Frequency and Distribution during Meiotic Recombination. Cold Spring Harb Symp Quant Biol 2017 82 223-234  [ PubMed ID = 29222342 ] [ RRC reference ] Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B. Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans. Nucleic Acids Res 2017 45(16) 9467-9480  [ PubMed ID = 28934497 ] [ RRC reference ] Kessler Z, Yanowitz J. Methodological considerations for mutagen exposure in C. elegans. Methods 2014 68(3) 441-9  [ PubMed ID = 24768858 ] [ RRC reference ] Agostinho A, Meier B, Sonneville R, Jagut M, Woglar A, Blow J, Jantsch V, Gartner A. Combinatorial regulation of meiotic holliday junction resolution in C. elegans by HIM-6 (BLM) helicase, SLX-4, and the SLX-1, MUS-81 and XPF-1 nucleases. PLoS Genet 2013 9(7) e1003591  [ PubMed ID = 23901331 ] [ RRC reference ] Saito TT, Mohideen F, Meyer K, Harper JW, Colaiácovo MP. SLX-1 is required for maintaining genomic integrity and promoting meiotic noncrossovers in the Caenorhabditis elegans germline. PLoS Genet 2012 8(8) e1002888  [ PubMed ID = 22927825 ] [ RRC reference ]