| Allele Name | tm2639 |
| Allele Type | 通常株 |
| Sequence Name | T05C12.6 |
| Gene Name | mig-5 |
| Worm Base | Allele Name |
tm2639
|
| Gene Name |
mig-5
|
| Sequence |
T05C12.6
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. H. Sawa: QL cell migration abonormal, some animals have one or no gonadal arms, not Psa. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 15686/15687-ATATT-16497/16498 (811 bp deletion + 5 bp insertion) |
| Chromosome | II |
| Putative gene structure | complement(join(14324..14472, 14636..15160, 15209..15534, 15581..15703, 15746..16223, 16276..16351, 16393..16546, 16601..16749, 16816..16854)) |
| Map position | 0.75 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:ACCCGGATATTCAACGGTGA,IntRev:TGATTCGGATCGGCTGCGCA,ExtFwd:GTGTCCGTGGAATTACGATC,IntFwd:CTTGCTGACGACATGTCTGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Riva C, Hajduskova M, Gally C, Suman SK, Ahier A, Jarriault S.
A natural transdifferentiation event involving mitosis is empowered by integrating signaling inputs with conserved plasticity factors.
Cell Rep 2022 40(12) 111365
[ PubMed ID = 36130499 ]
[ RRC reference ]
|
Lu M, Mizumoto K.
Gradient-independent Wnt signaling instructs asymmetric neurite pruning in C. elegans.
Elife 2019 8
[ PubMed ID = 31804181 ]
[ RRC reference ]
|
Baldwin AT, Clemons AM, Phillips BT.
Unique and redundant β-catenin regulatory roles of two Dishevelled paralogs during C. elegans asymmetric cell division.
J Cell Sci 2016 129(5) 983-93
[ PubMed ID = 26795562 ]
[ RRC reference ]
|
Sanchez-Alvarez L, Visanuvimol J, McEwan A, Su A, Imai JH, Colavita A.
VANG-1 and PRKL-1 cooperate to negatively regulate neurite formation in Caenorhabditis elegans.
PLoS Genet 2011 7(9) e1002257
[ PubMed ID = 21912529 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.