| Allele Name | tm2621 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | H04M03.4 |
| Gene Name | glf-1 |
| Worm Base | Allele Name |
tm2621
(x1) |
| Gene Name |
glf-1
|
| Sequence |
H04M03.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 16853/16854-17136/17137 (283 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(15094..15213, 15800..16090, 16788..17150, 17220..17381, 17607..17798, 17903..18031, 18632..18832) |
| Map position | 2.71 |
| Balancer | nT1 [qIs51] |
| Map position of balancer | |
| Sequence of primers | IntRev:CTCACGAGTGATCATATCCT,ExtRev:CCGACTCAATAGCCTCACGA,IntFwd:AGACGGAACTACCCCAGACA,ExtFwd:ACCCAGTCATGCTGGCTAAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Hall AN, Morton EA, Walters R, Cuperus JT, Queitsch C.
Phenotypic tolerance for rDNA copy number variation within the natural range of C. elegans.
PLoS Genet 2025 21(7) e1011759
[ PubMed ID = 40601579 ]
[ RRC reference ]
|
Novelli JF, Chaudhary K, Canovas J, Benner JS, Madinger CL, Kelly P, Hodgkin J, Carlow CK.
Characterization of the Caenorhabditis elegans UDP-galactopyranose mutase homolog glf-1 reveals an essential role for galactofuranose metabolism in nematode surface coat synthesis.
Dev Biol 2009 335(2) 340-55
[ PubMed ID = 19751718 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.