分離済み変異体

tm2616

Allele Nametm2616
BalanceNot Required
OutCrossNot Accepted
Sequence NameF56F10.4
Gene Namelgl-1
Worm BaseAllele Name tm2616
Gene Name lgl-1
Sequence F56F10.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16636/16637-CACACCGAA-16847/16848 (211 bp deletion + 9 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(13138..13275, 13667..13773, 13826..13979, 14184..14416, 14568..14825, 15005..15497, 15546..15776, 16654..17044, 17190..17386, 17433..17671, 18019..18129, 18484..18721, 18973..19059))
Map position-19.47
Balancer
Map position of balancer
Sequence of primersExtFwd:CGACTGAGCTATCTGCCCTA,ExtRev:CTAGGTTTACCGTAACAGGA,IntFwd:CTATCTGCCCTACTATGAGA,IntRev:AATGGCTGCCTGACGACACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu H, Wang S, Hang W, Gao J, Zhang W, Cheng Z, Yang C, He J, Zhou J, Chen J, Shi A.
LET-413/Erbin acts as a RAB-5 effector to promote RAB-10 activation during endocytic recycling.
J Cell Biol 2018 217(1) 299-314 
[ PubMed ID = 29079669 ] [ RRC reference ]

Rodriguez J, Peglion F, Martin J, Hubatsch L, Reich J, Hirani N, Gubieda AG, Roffey J, Fernandes AR, St Johnston D, Ahringer J, Goehring NW.
aPKC Cycles between Functionally Distinct PAR Protein Assemblies to Drive Cell Polarity.
Dev Cell 2017 42(4) 400-415.e9 
[ PubMed ID = 28781174 ] [ RRC reference ]

Waaijers S, Muñoz J, Berends C, Ramalho JJ, Goerdayal SS, Low TY, Zoumaro-Djayoon AD, Hoffmann M, Koorman T, Tas RP, Harterink M, Seelk S, Kerver J, Hoogenraad CC, Bossinger O, Tursun B, van den Heuvel S, Heck AJ, Boxem M.
A tissue-specific protein purification approach in Caenorhabditis elegans identifies novel interaction partners of DLG-1/Discs large.
BMC Biol 2016 14 66 
[ PubMed ID = 27506200 ] [ RRC reference ]

Sailer A, Anneken A, Li Y, Lee S, Munro E.
Dynamic Opposition of Clustered Proteins Stabilizes Cortical Polarity in the C. elegans Zygote.
Dev Cell 2015 35(1) 131-42 
[ PubMed ID = 26460948 ] [ RRC reference ]

Beatty A, Morton DG, Kemphues K.
PAR-2, LGL-1 and the CDC-42 GAP CHIN-1 act in distinct pathways to maintain polarity in the C. elegans embryo.
Development 2013 140(9) 2005-14 
[ PubMed ID = 23536568 ] [ RRC reference ]

McCloskey RJ, Kemphues KJ.
Deubiquitylation machinery is required for embryonic polarity in Caenorhabditis elegans.
PLoS Genet 2012 8(11) e1003092 
[ PubMed ID = 23209443 ] [ RRC reference ]

Beatty A, Morton D, Kemphues K.
The C. elegans homolog of Drosophila Lethal giant larvae functions redundantly with PAR-2 to maintain polarity in the early embryo.
Development 2010 137(23) 3995-4004 
[ PubMed ID = 21041363 ] [ RRC reference ]