| Allele Name | tm2613 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F53H8.4 |
| Gene Name | sms-2 |
| Worm Base | Allele Name |
tm2613
|
| Gene Name |
sms-2
|
| Sequence |
F53H8.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 7943/7944-8225/8226 (282 bp deletion) |
| Chromosome | X |
| Putative gene structure | complement(join(7501..7633, 8034..8210, 8278..8427, 8905..9111, 9742..9965, 11000..11116)) |
| Map position | -18.92 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:ATTAAAGTGCAGGGTGACCA,ExtFwd:CATTAACTTGGCCAGTGCAG,IntFwd:TGGCCAGTGCAGTTTACCAC,ExtRev:TCTGCTTACATTGGGCACAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Guzman G, Jahn H, Farley SE, Kyle JE, Bramer LM, Hoetzl S, van den Dikkenberg J, Hermansson M, Holthuis JCM, Tafesse FG. Characterization of Caenorhabditis elegans sphingomyelin synthases through heterologous expression. J Biol Chem 2025 301(7) 110300
[ PubMed ID = 40473211 ]
[ RRC reference ]
|
Hao L, Ben-David O, Babb SM, Futerman AH, Cohen BM, Buttner EA. Clozapine Modulates Glucosylceramide, Clears Aggregated Proteins, and Enhances ATG8/LC3 in Caenorhabditis elegans. Neuropsychopharmacology 2017 42(4) 951-962
[ PubMed ID = 27711049 ]
[ RRC reference ]
|
|