Home > 分離済み変異体 > tm2595

分離済み変異体

Allele Name		tm2595
Balance		Not Required
OutCross		Not Accepted
Sequence Name		ZK20.3
Gene Name		rad-23
Worm Base	Allele Name	tm2595
	Gene Name	rad-23
	Sequence	ZK20.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. W. Vermeulen: survival is not affected by UV irradiation. Dr. A. Colavita: J. Neurosci. 305, 1766 (2010).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		30380/30381-ATTCAAAAGATCCATGAAAGCAAGCTTG-31057/31058 (677 bp deletion + 28 bp insertion)
Chromosome		II
Putative gene structure		complement(join(30077..30088, 30143..30946, 30996..31079, 31126..31198, 31319..31464))
Map position		3.82
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GTCACATGCGAAATAAGCCT,IntFwd:CATGCGAAATAAGCCTCCAC,ExtRev:CCTTTAAGACGCCAAGCCAT,IntRev:CAGGATGGTTTTGTCCGTTA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Eck RJ, Stair JG, Kraemer BC, Liachko NF. Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Front Neurosci 2023 17 1300705  [ PubMed ID = 38239833 ] [ RRC reference ] Zhou Q, Li H, Li H, Nakagawa A, Lin JL, Lee ES, Harry BL, Skeen-Gaar RR, Suehiro Y, William D, Mitani S, Yuan HS, Kang BH, Xue D. Mitochondrial endonuclease G mediates breakdown of paternal mitochondria upon fertilization. Science 2016 353(6297) 394-9  [ PubMed ID = 27338704 ] [ RRC reference ] Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG. Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance. J Neurosci 2015 35(42) 14286-306  [ PubMed ID = 26490867 ] [ RRC reference ] Kuhlbrodt K, Janiesch PC, Kevei É, Segref A, Barikbin R, Hoppe T. The Machado-Joseph disease deubiquitylase ATX-3 couples longevity and proteostasis. Nat Cell Biol 2011 13(3) 273-81  [ PubMed ID = 21317884 ] [ RRC reference ] Lans H, Vermeulen W. Nucleotide Excision Repair in Caenorhabditis elegans. Mol Biol Int 2011 2011 542795  [ PubMed ID = 22091407 ] [ RRC reference ] Lans H, Marteijn JA, Schumacher B, Hoeijmakers JH, Jansen G, Vermeulen W. Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during development. PLoS Genet 2010 6(5) e1000941  [ PubMed ID = 20463888 ] [ RRC reference ] Habibi-Babadi N, Su A, de Carvalho CE, Colavita A. The N-glycanase png-1 acts to limit axon branching during organ formation in Caenorhabditis elegans. J Neurosci 2010 30(5) 1766-76  [ PubMed ID = 20130186 ] [ RRC reference ]