分離済み変異体

tm2580

Allele Nametm2580
BalanceNot Required
OutCrossNot Accepted
Sequence NameF46G10.6
Gene Namemxl-3
Worm BaseAllele Name tm2580
Gene Name mxl-3
Sequence F46G10.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Ruvukun: slight growth delay, no hypersensitivity to RNAi.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [C49F8] 831/832-[C49F8]1902/1903 (1071 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(C49F8: 1006..1201, C49F8: 1257..1401, C49F8: 1454..1727, C49F8: 1779..1871))
Map position11.7
Balancer
Map position of balancer
Sequence of primersExtFwd:GTATACGACTACTGACGCGT,IntFwd:CGACTACTGACGCGTATATT,ExtRev:TTGCACCCGACCGTCACCAT,IntRev:GACATCCCCGTGTTGCCATA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

O'Rourke EJ, Ruvkun G.
MXL-3 and HLH-30 transcriptionally link lipolysis and autophagy to nutrient availability.
Nat Cell Biol 2013 15(6) 668-76 
[ PubMed ID = 23604316 ] [ RRC reference ]