Allele Name | tm2571 |
Allele Type | バランス済 |
Sequence Name | Y37E3.9 |
Gene Name | phb-1 |
Worm Base | Allele Name |
tm2571
|
Gene Name |
phb-1
|
Sequence |
Y37E3.9
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 12455/12456-AAAA-12917/12918 (462 bp deletion + 4 bp insertion) |
Chromosome | I |
Putative gene structure | join(12254..12655, 12725..12841, 12891..13199) |
Map position | -11.89 |
Balancer | hT2 |
Map position of balancer | |
Sequence of primers | IntFwd:ACAGAAGCTTTTGGGTCGCT,ExtFwd:CGATGAAATGCAGCCTCCCT,IntRev:CTTGTTCTTGGCCATACGCT,ExtRev:GTCTAAAACACGTAACCGGA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Hernando-Rodríguez B, Erinjeri AP, Rodríguez-Palero MJ, Millar V, González-Hernández S, Olmedo M, Schulze B, Baumeister R, Muñoz MJ, Askjaer P, Artal-Sanz M. Combined flow cytometry and high-throughput image analysis for the study of essential genes in Caenorhabditis elegans. BMC Biol 2018 16(1) 36
[ PubMed ID = 29598825 ]
[ RRC reference ]
|
Artal-Sanz M, Tavernarakis N. Prohibitin couples diapause signalling to mitochondrial metabolism during ageing in C. elegans. Nature 2009 461(7265) 793-7
[ PubMed ID = 19812672 ]
[ RRC reference ]
|
|