分離済み変異体

tm2569

Allele Nametm2569
BalanceNot Required
OutCrossNot Accepted
Sequence NameY47D3B.2
Gene Namenlp-21
Worm BaseAllele Name tm2569
Gene Name nlp-21
Sequence Y47D3B.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Kaplan: Ric. Dr. Z-X. Wu: normal chemotaxis against glycerol, Cu and normal nose touch response. Dr. I. Mori: normal thermotaxis at 20C.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13461/13462-13806/13807 (345 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(12895..12950, 13560..13955, 17307..17349))
Map position9.09
Balancer
Map position of balancer
Sequence of primersIntRev:TGTACTCCCACTGCTCTATT,ExtFwd:TCTAGCCATGGAATCCTTGT,IntFwd:CACATGGCACATGGTGCAAC,ExtRev:GAGAGGTTGTATCTCGGTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shao J, Liewald JF, Steuer Costa W, Ruse C, Gruber J, Djamshedzad MS, Gebhardt W, Gottschalk A.
Loss of neuropeptidergic regulation of cholinergic transmission induces homeostatic compensation in muscle cells to preserve synaptic strength.
PLoS Biol 2025 23(5) e3003171 
[ PubMed ID = 40338987 ] [ RRC reference ]

Wang PZ, Ge MH, Su P, Wu PP, Wang L, Zhu W, Li R, Liu H, Wu JJ, Xu Y, Zhao JL, Li SJ, Wang Y, Chen LM, Wu TH, Wu ZX.
Sensory plasticity caused by up-down regulation encodes the information of short-term learning and memory.
iScience 2025 28(4) 112215 
[ PubMed ID = 40224011 ] [ RRC reference ]

Chen YC, Zang KE, Ahamed H, Ringstad N.
Food sensing controls C. elegans reproductive behavior by neuromodulatory disinhibition.
Sci Adv 2025 11(16) eadu5829 
[ PubMed ID = 40238881 ] [ RRC reference ]

Xue W, Chen Y, Lei Z, Wang Y, Liu J, Wen X, Xu F, Chen P, Wu Z, Jin YN, Yu YV.
Calcium levels in ASER neurons determine behavioral valence by engaging distinct neuronal circuits in C. elegans.
Nat Commun 2025 16(1) 1814 
[ PubMed ID = 39979341 ] [ RRC reference ]

Nakayama A, Watanabe M, Yamashiro R, Kuroyanagi H, Matsuyama HJ, Oshima A, Mori I, Nakano S.
A hyperpolarizing neuron recruits undocked innexin hemichannels to transmit neural information in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(21) e2406565121 
[ PubMed ID = 38753507 ] [ RRC reference ]

Fay DS, Polley SR, Kuang J, Kuzmanov A, Hazel JW, Mani K, Veo BL, Yochem J.
A regulatory module controlling pharyngeal development and function in Caenorhabditis elegans.
Genetics 2012 191(3) 827-43 
[ PubMed ID = 22542967 ] [ RRC reference ]