分離済み変異体

tm2560

Allele Nametm2560
BalanceNot Required
OutCrossNot Accepted
Sequence NameZK84.3
Gene Nameins-5
Worm BaseAllele Name tm2560
Gene Name ins-5
Sequence ZK84.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. T. Katada: No abnormal proliferation in Z2/Z3 cells during L1 diapause. Dr. M. Driscoll: normal dauer formation. Dr. P.W. Sternberg: normal locomotion. Dr. J. Kaplan: slight increase in Nile Red staining.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1996/1997-CAT-2253/2254 (257 bp deletion + 3 bp insertion)
ChromosomeII
Putative gene structurejoin(2002..2216, 2267..2306)
Map position-0.71
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCTCCTTGCGCCATGATGT,IntFwd:GCTCCTCCCATGTTGGATTG,ExtRev:ATCCTTGAATGCCCGTGAGT,IntRev:GGTTTCAGGAGGGTGACGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang MG, Seyedolmohadesin M, Mercado SH, Tauffenberger A, Park H, Finnen N, Schroeder FC, Venkatachalam V, Sternberg PW.
Sensory integration of food and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(40) e2405391121 
[ PubMed ID = 39316052 ] [ RRC reference ]

Zhang MG, Seyedolmohadesin M, Hawk S, Park H, Finnen N, Schroeder F, Venkatachalam V, Sternberg PW.
Sensory integration of food availability and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans.
bioRxiv 2024   
[ PubMed ID = 38586049 ] [ RRC reference ]

Segref A, Vakkayil KL, Padvitski T, Li Q, Kroef V, Lormann J, Körner L, Finger F, Hoppe T.
Thermosensation in Caenorhabditis elegans is linked to ubiquitin-dependent protein turnover via insulin and calcineurin signalling.
Nat Commun 2022 13(1) 5874 
[ PubMed ID = 36198694 ] [ RRC reference ]

Yanase S, Yasuda K, Ishii N.
Interaction between the ins/IGF-1 and p38 MAPK signaling pathways in molecular compensation of sod genes and modulation related to intracellular ROS levels in C. elegans.
Biochem Biophys Rep 2020 23 100796 
[ PubMed ID = 32875124 ] [ RRC reference ]

Yanase S, Yasuda K, Ishii N.
Interaction between the ins/IGF-1 and p38 MAPK signaling pathways in molecular compensation of sod genes and modulation related to intracellular ROS levels in C. elegans.
Biochem Biophys Rep 2020 23 100796 
[ PubMed ID = 32875124 ] [ RRC reference ]

Schiffer JA, Servello FA, Heath WR, Amrit FRG, Stumbur SV, Eder M, Martin OM, Johnsen SB, Stanley JA, Tam H, Brennan SJ, McGowan NG, Vogelaar AL, Xu Y, Serkin WT, Ghazi A, Stroustrup N, Apfeld J.
Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies.
Elife 2020 9  
[ PubMed ID = 32367802 ] [ RRC reference ]

Wu T, Duan F, Yang W, Liu H, Caballero A, Fernandes de Abreu DA, Dar AR, Alcedo J, Ch'ng Q, Butcher RA, Zhang Y.
Pheromones Modulate Learning by Regulating the Balanced Signals of Two Insulin-like Peptides.
Neuron 2019 104(6) 1095-1109.e5 
[ PubMed ID = 31676170 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2017 484(2) 323-330 
[ PubMed ID = 28131836 ] [ RRC reference ]

Burton NO, Furuta T, Webster AK, Kaplan RE, Baugh LR, Arur S, Horvitz HR.
Insulin-like signalling to the maternal germline controls progeny response to osmotic stress.
Nat Cell Biol 2017 19(3) 252-257 
[ PubMed ID = 28166192 ] [ RRC reference ]

Fukuyama M, Kontani K, Katada T, Rougvie AE.
The C. elegans Hypodermis Couples Progenitor Cell Quiescence to the Dietary State.
Curr Biol 2015 25(9) 1241-8 
[ PubMed ID = 25891400 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev Biol 2014 394(2) 314-26 
[ PubMed ID = 25128585 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79 
[ PubMed ID = 24671950 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60 
[ PubMed ID = 23665919 ] [ RRC reference ]

Baugh LR, Kurhanewicz N, Sternberg PW.
Sensitive and precise quantification of insulin-like mRNA expression in Caenorhabditis elegans.
PLoS One 2011 6(3) e18086 
[ PubMed ID = 21445366 ] [ RRC reference ]