分離済み変異体

tm2547

Allele Nametm2547
BalanceNot Required
OutCrossNot Accepted
Sequence NameF35D2.4
Gene Namemks-3
Worm BaseAllele Name tm2547
Gene Name mks-3
Sequence F35D2.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. P. Swoboda: Dyf(+), Osm(+). Dr.K. Oegema: wild-type dyf.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 18469/18470-19418/19419 (949 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(17044..17370, 17421..17532, 17587..17761, 17803..18019, 18294..18572, 18620..19028, 19090..19304, 19352..19486, 19540..19742, 19806..19927, 20008..20057))
Map position0.5
Balancer
Map position of balancer
Sequence of primersExtRev:CCGCACAACATCACCATGAC,IntRev:ACCATGACAACGTGGTTCGT,ExtFwd:GGTTCCTCATGTATTGGCCA,IntFwd:TGGCCAAACATGCCTGTCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ahmed M, Fischer S, Robert KL, Lange KI, Stuck MW, Best S, Johnson CA, Pazour GJ, Blacque OE, Nandadasa S.
Two functional forms of the Meckel-Gruber syndrome protein TMEM67 generated by proteolytic cleavage by ADAMTS9 mediate Wnt signaling and ciliogenesis.
bioRxiv 2024   
[ PubMed ID = 39282264 ] [ RRC reference ]

Lange KI, Best S, Tsiropoulou S, Berry I, Johnson CA, Blacque OE.
Interpreting ciliopathy-associated missense variants of uncertain significance (VUS) in Caenorhabditis elegans.
Hum Mol Genet 2022 31(10) 1574-1587 
[ PubMed ID = 34964473 ] [ RRC reference ]

Jensen VL, Carter S, Sanders AA, Li C, Kennedy J, Timbers TA, Cai J, Scheidel N, Kennedy BN, Morin RD, Leroux MR, Blacque OE.
Whole-Organism Developmental Expression Profiling Identifies RAB-28 as a Novel Ciliary GTPase Associated with the BBSome and Intraflagellar Transport.
PLoS Genet 2016 12(12) e1006469 
[ PubMed ID = 27930654 ] [ RRC reference ]

Wei Q, Zhang Y, Schouteden C, Zhang Y, Zhang Q, Dong J, Wonesch V, Ling K, Dammermann A, Hu J.
The hydrolethalus syndrome protein HYLS-1 regulates formation of the ciliary gate.
Nat Commun 2016 7 12437 
[ PubMed ID = 27534274 ] [ RRC reference ]

Yee LE, Garcia-Gonzalo FR, Bowie RV, Li C, Kennedy JK, Ashrafi K, Blacque OE, Leroux MR, Reiter JF.
Conserved Genetic Interactions between Ciliopathy Complexes Cooperatively Support Ciliogenesis and Ciliary Signaling.
PLoS Genet 2015 11(11) e1005627 
[ PubMed ID = 26540106 ] [ RRC reference ]

Warburton-Pitt SR, Jauregui AR, Li C, Wang J, Leroux MR, Barr MM.
Ciliogenesis in Caenorhabditis elegans requires genetic interactions between ciliary middle segment localized NPHP-2 (inversin) and transition zone-associated proteins.
J Cell Sci 2012 125(Pt 11) 2592-603 
[ PubMed ID = 22393243 ] [ RRC reference ]

Huang L, Szymanska K, Jensen VL, Janecke AR, Innes AM, Davis EE, Frosk P, Li C, Willer JR, Chodirker BN, Greenberg CR, McLeod DR, Bernier FP, Chudley AE, Müller T, Shboul M, Logan CV, Loucks CM, Beaulieu CL, Bowie RV, Bell SM, Adkins J, Zuniga FI, Ross KD, Wang J, Ban MR, Becker C, Nürnberg P, Douglas S, Craft CM, Akimenko MA, Hegele RA, Ober C, Utermann G, Bolz HJ, Bulman DE, Katsanis N, Blacque OE, Doherty D, Parboosingh JS, Leroux MR, Johnson CA, Boycott KM.
TMEM237 is mutated in individuals with a Joubert syndrome related disorder and expands the role of the TMEM family at the ciliary transition zone.
Am J Hum Genet 2011 89(6) 713-30 
[ PubMed ID = 22152675 ] [ RRC reference ]

Williams CL, Masyukova SV, Yoder BK.
Normal ciliogenesis requires synergy between the cystic kidney disease genes MKS-3 and NPHP-4.
J Am Soc Nephrol 2010 21(5) 782-93 
[ PubMed ID = 20150540 ] [ RRC reference ]