分離済み変異体

tm2543

Allele Nametm2543
BalanceNot Required
OutCrossNot Accepted
Sequence NameY73B6BL.2
Gene Namehtp-2
Worm BaseAllele Name tm2543
Gene Name htp-2
Sequence Y73B6BL.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. A. Dernburg: very weak Him (~1%). Dr. E. Marinez-Perez: Genes & Dev. 22, 2886 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 133607/133608-GGCTGTTCTC-133766/133767 (159 bp deletion + 10 bp insertion)
ChromosomeIV
Putative gene structurejoin(133377..133466, 133512..133659, 133706..134439, 134489..134599)
Map position3.2
Balancer
Map position of balancer
Sequence of primersIntFwd:GACCCGGATCGATCGTCCAA,ExtFwd:AGCATTGTCAGCGACCCGGA,IntRev:TCGAAGCCATCGATGCGGAA,ExtRev:GGTGACCGATTGGATACCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zetka M, Pezeshki A, Dawson R, Huis In 't Veld PJ, Jones SJM, Silva N.
A nuclear TRiC/CCT chaperonin assembles meiotic HORMAD proteins into chromosome axes competent for crossing over.
Nat Commun 2025 16(1) 9411 
[ PubMed ID = 41136395 ] [ RRC reference ]

Blazickova J, Trivedi S, Bowman R, Sivakumar Geetha S, Subah S, Scuzzarella M, Chang A, Chandran UR, Yanowitz JL, Smolikove S, Jantsch V, Zetka M, Silva N.
Overlapping and separable activities of BRA-2 and HIM-17 promote occurrence and regulation of pairing and synapsis during Caenorhabditis elegans meiosis.
Nat Commun 2025 16(1) 2516 
[ PubMed ID = 40082424 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Russo AE, Giacopazzi S, Deshong A, Menon M, Ortiz V, Ego KM, Corbett KD, Bhalla N.
The conserved AAA ATPase PCH-2 distributes its regulation of meiotic prophase events through multiple meiotic HORMADs in C. elegans.
PLoS Genet 2023 19(4) e1010708 
[ PubMed ID = 37058535 ] [ RRC reference ]

Loose JA, Amrit FRG, Patil T, Yanowitz JL, Ghazi A.
Meiotic dysfunction accelerates somatic aging in Caenorhabditis elegans.
Aging Cell 2022 21(11) e13716 
[ PubMed ID = 36176234 ] [ RRC reference ]

Woglar A, Yamaya K, Roelens B, Boettiger A, Köhler S, Villeneuve AM.
Quantitative cytogenetics reveals molecular stoichiometry and longitudinal organization of meiotic chromosome axes and loops.
PLoS Biol 2020 18(8) e3000817 
[ PubMed ID = 32813728 ] [ RRC reference ]

Ferrandiz N, Barroso C, Telecan O, Shao N, Kim HM, Testori S, Faull P, Cutillas P, Snijders AP, Colaiácovo MP, Martinez-Perez E.
Spatiotemporal regulation of Aurora B recruitment ensures release of cohesion during C. elegans oocyte meiosis.
Nat Commun 2018 9(1) 834 
[ PubMed ID = 29483514 ] [ RRC reference ]

Bohr T, Ashley G, Eggleston E, Firestone K, Bhalla N.
Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans.
Genetics 2016 204(3) 987-997 
[ PubMed ID = 27605049 ] [ RRC reference ]

Roelens B, Schvarzstein M, Villeneuve AM.
Manipulation of Karyotype in Caenorhabditis elegans Reveals Multiple Inputs Driving Pairwise Chromosome Synapsis During Meiosis.
Genetics 2015 201(4) 1363-79 
[ PubMed ID = 26500263 ] [ RRC reference ]

Kim Y, Kostow N, Dernburg AF.
The Chromosome Axis Mediates Feedback Control of CHK-2 to Ensure Crossover Formation in C. elegans.
Dev Cell 2015 35(2) 247-61 
[ PubMed ID = 26506311 ] [ RRC reference ]

Schvarzstein M, Pattabiraman D, Bembenek JN, Villeneuve AM.
Meiotic HORMA domain proteins prevent untimely centriole disengagement during Caenorhabditis elegans spermatocyte meiosis.
Proc Natl Acad Sci U S A 2013 110(10) E898-907 
[ PubMed ID = 23401519 ] [ RRC reference ]

Martinez-Perez E, Schvarzstein M, Barroso C, Lightfoot J, Dernburg AF, Villeneuve AM.
Crossovers trigger a remodeling of meiotic chromosome axis composition that is linked to two-step loss of sister chromatid cohesion.
Genes Dev 2008 22(20) 2886-901 
[ PubMed ID = 18923085 ] [ RRC reference ]