分離済み変異体

tm2526

Allele Nametm2526
BalanceNot Required
OutCrossNot Accepted
Sequence NameD1037.4
Gene Namerab-8
Worm BaseAllele Name tm2526
Gene Name rab-8
Sequence D1037.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Blacque: dye-filling normal. Dr. K. Sato: Nature448, 366 (2007). Dr. S. Eimer: normal levamisole receptor trafficking. Dr. H.C. Korswagen: no QL migration defect or ALM/PLM polarity defects.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 22868/22869-23109/23110 (241 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(22559..22948, 23008..23068, 23116..23270, 23318..23347))
Map position-2.95
Balancer
Map position of balancer
Sequence of primersIntFwd:CTTCTTCTGTGTCCCCGATC,ExtFwd:TATGCGAGAGAGAGCGGACA,IntRev:CTTTTGCATGCCAAGATGTC,ExtRev:CCGGGACCCATCAGTGTCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li X, Liu B, Wen Y, Wang J, Guo YR, Shi A, Lin L.
Coordination of RAB-8 and RAB-11 during unconventional protein secretion.
J Cell Biol 2024 223(2)  
[ PubMed ID = 38019180 ] [ RRC reference ]

Wang X, Li X, Wang J, Wang J, Hu C, Zeng J, Shi A, Lin L.
SMGL-1/NBAS acts as a RAB-8 GEF to regulate unconventional protein secretion.
J Cell Biol 2022 221(7)  
[ PubMed ID = 35604368 ] [ RRC reference ]

Lin-Moore AT, Oyeyemi MJ, Hammarlund M.
rab-27 acts in an intestinal pathway to inhibit axon regeneration in C. elegans.
PLoS Genet 2021 17(11) e1009877 
[ PubMed ID = 34818334 ] [ RRC reference ]

Choi J, Sung JY, Lee S, Yoo J, Rongo C, Kim YN, Shim J.
Rab8 and Rabin8-Mediated Tumor Formation by Hyperactivated EGFR Signaling via FGFR Signaling.
Int J Mol Sci 2020 21(20)  
[ PubMed ID = 33092268 ] [ RRC reference ]

Androwski RJ, Asad N, Wood JG, Hofer A, Locke S, Smith CM, Rose B, Schroeder NE.
Mutually exclusive dendritic arbors in C. elegans neurons share a common architecture and convergent molecular cues.
PLoS Genet 2020 16(9) e1009029 
[ PubMed ID = 32997655 ] [ RRC reference ]

Gao J, Zhao L, Luo Q, Liu S, Lin Z, Wang P, Fu X, Chen J, Zhang H, Lin L, Shi A.
An EHBP-1-SID-3-DYN-1 axis promotes membranous tubule fission during endocytic recycling.
PLoS Genet 2020 16(5) e1008763 
[ PubMed ID = 32384077 ] [ RRC reference ]

Chen D, Xu W, Wang Y, Ye Y, Wang Y, Yu M, Gao J, Wei J, Dong Y, Zhang H, Fu X, Ma K, Wang H, Yang Z, Zhou J, Cheng W, Wang S, Chen J, Grant BD, Myers CL, Shi A, Xia T.
Revealing Functional Crosstalk between Distinct Bioprocesses through Reciprocal Functional Tests of Genetically Interacting Genes.
Cell Rep 2019 29(9) 2646-2658.e5 
[ PubMed ID = 31775035 ] [ RRC reference ]

Laurent P, Ch'ng Q, Jospin M, Chen C, Lorenzo R, de Bono M.
Genetic dissection of neuropeptide cell biology at high and low activity in a defined sensory neuron.
Proc Natl Acad Sci U S A 2018 115(29) E6890-E6899 
[ PubMed ID = 29959203 ] [ RRC reference ]

Zou W, Yadav S, DeVault L, Nung Jan Y, Sherwood DR.
RAB-10-Dependent Membrane Transport Is Required for Dendrite Arborization.
PLoS Genet 2015 11(9) e1005484 
[ PubMed ID = 26394140 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84 
[ PubMed ID = 24646679 ] [ RRC reference ]

Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P.
Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.
J Cell Sci 2013 126(Pt 19) 4381-95 
[ PubMed ID = 23886944 ] [ RRC reference ]

Olivier-Mason A, Wojtyniak M, Bowie RV, Nechipurenko IV, Blacque OE, Sengupta P.
Transmembrane protein OSTA-1 shapes sensory cilia morphology via regulation of intracellular membrane trafficking in C. elegans.
Development 2013 140(7) 1560-72 
[ PubMed ID = 23482491 ] [ RRC reference ]

Shi A, Liu O, Koenig S, Banerjee R, Chen CC, Eimer S, Grant BD.
RAB-10-GTPase-mediated regulation of endosomal phosphatidylinositol-4,5-bisphosphate.
Proc Natl Acad Sci U S A 2012 109(35) E2306-15 
[ PubMed ID = 22869721 ] [ RRC reference ]

Kaplan OI, Doroquez DB, Cevik S, Bowie RV, Clarke L, Sanders AA, Kida K, Rappoport JZ, Sengupta P, Blacque OE.
Endocytosis genes facilitate protein and membrane transport in C. elegans sensory cilia.
Curr Biol 2012 22(6) 451-60 
[ PubMed ID = 22342749 ] [ RRC reference ]

Kaplan OI, Molla-Herman A, Cevik S, Ghossoub R, Kida K, Kimura Y, Jenkins P, Martens JR, Setou M, Benmerah A, Blacque OE.
The AP-1 clathrin adaptor facilitates cilium formation and functions with RAB-8 in C. elegans ciliary membrane transport.
J Cell Sci 2010 123(Pt 22) 3966-77 
[ PubMed ID = 20980383 ] [ RRC reference ]

Mukhopadhyay S, Lu Y, Shaham S, Sengupta P.
Sensory signaling-dependent remodeling of olfactory cilia architecture in C. elegans.
Dev Cell 2008 14(5) 762-74 
[ PubMed ID = 18477458 ] [ RRC reference ]

Sato T, Mushiake S, Kato Y, Sato K, Sato M, Takeda N, Ozono K, Miki K, Kubo Y, Tsuji A, Harada R, Harada A.
The Rab8 GTPase regulates apical protein localization in intestinal cells.
Nature 2007 448(7151) 366-9 
[ PubMed ID = 17597763 ] [ RRC reference ]