| Allele Name | tm2523 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | F25B3.1 |
| Gene Name | ehbp-1 |
| Worm Base | Allele Name |
tm2523
(x1) |
| Gene Name |
ehbp-1
|
| Sequence |
F25B3.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. H. Bellen: Ste and Sck. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 1245/1246-1748/1749 (503 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(Z70750.1:35823..35897, Z70750.1:35940..36004, 110..564, 616..744, 1065..1284, 1334..2021, 2472..2637, 2738..2815, 2894..2953, 3047..3108, 3731..3850, 3965..4120, 4169..4482, 4740..4857) |
| Map position | 2.05 |
| Balancer | nT1,nT1 [qIs51] |
| Map position of balancer | |
| Sequence of primers | ExtRev:ACTCCTGGAGTCACCATGGT,IntRev:GTCACCATGGTTATGCTTAC,ExtFwd:ACCGACACCCGTGGCTCTTA,IntFwd:CCGTGGCTCTTATAGAATGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Liu H, Wang S, Hang W, Gao J, Zhang W, Cheng Z, Yang C, He J, Zhou J, Chen J, Shi A. LET-413/Erbin acts as a RAB-5 effector to promote RAB-10 activation during endocytic recycling. J Cell Biol 2018 217(1) 299-314
[ PubMed ID = 29079669 ]
[ RRC reference ]
|
Wang P, Liu H, Wang Y, Liu O, Zhang J, Gleason A, Yang Z, Wang H, Shi A, Grant BD. RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes. PLoS Genet 2016 12(6) e1006093
[ PubMed ID = 27272733 ]
[ RRC reference ]
|
Wang P, Liu H, Wang Y, Liu O, Zhang J, Gleason A, Yang Z, Wang H, Shi A, Grant BD. RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes. PLoS Genet 2016 12(6) e1006093
[ PubMed ID = 27272733 ]
[ RRC reference ]
|
Shi A, Chen CC, Banerjee R, Glodowski D, Audhya A, Rongo C, Grant BD. EHBP-1 functions with RAB-10 during endocytic recycling in Caenorhabditis elegans. Mol Biol Cell 2010 21(16) 2930-43
[ PubMed ID = 20573983 ]
[ RRC reference ]
|
|