分離済み変異体

tm2523

Allele Nametm2523
BalanceCompleted
OutCrossNot Accepted
Sequence NameF25B3.1
Gene Nameehbp-1
Worm BaseAllele Name tm2523 (x1)
Gene Name ehbp-1
Sequence F25B3.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. H. Bellen: Ste and Sck.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1245/1246-1748/1749 (503 bp deletion)
ChromosomeV
Putative gene structurejoin(Z70750.1:35823..35897, Z70750.1:35940..36004, 110..564, 616..744, 1065..1284, 1334..2021, 2472..2637, 2738..2815, 2894..2953, 3047..3108, 3731..3850, 3965..4120, 4169..4482, 4740..4857)
Map position2.05
BalancernT1,nT1 [qIs51]
Map position of balancer
Sequence of primersExtRev:ACTCCTGGAGTCACCATGGT,IntRev:GTCACCATGGTTATGCTTAC,ExtFwd:ACCGACACCCGTGGCTCTTA,IntFwd:CCGTGGCTCTTATAGAATGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Liu H, Wang S, Hang W, Gao J, Zhang W, Cheng Z, Yang C, He J, Zhou J, Chen J, Shi A.
LET-413/Erbin acts as a RAB-5 effector to promote RAB-10 activation during endocytic recycling.
J Cell Biol 2018 217(1) 299-314 
[ PubMed ID = 29079669 ] [ RRC reference ]

Wang P, Liu H, Wang Y, Liu O, Zhang J, Gleason A, Yang Z, Wang H, Shi A, Grant BD.
RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes.
PLoS Genet 2016 12(6) e1006093 
[ PubMed ID = 27272733 ] [ RRC reference ]

Wang P, Liu H, Wang Y, Liu O, Zhang J, Gleason A, Yang Z, Wang H, Shi A, Grant BD.
RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes.
PLoS Genet 2016 12(6) e1006093 
[ PubMed ID = 27272733 ] [ RRC reference ]

Shi A, Chen CC, Banerjee R, Glodowski D, Audhya A, Rongo C, Grant BD.
EHBP-1 functions with RAB-10 during endocytic recycling in Caenorhabditis elegans.
Mol Biol Cell 2010 21(16) 2930-43 
[ PubMed ID = 20573983 ] [ RRC reference ]