分離済み変異体

tm252

Allele Nametm252
BalanceNot Required
OutCrossNot Accepted
Sequence NameC39E6.4
Gene Namemls-2
Worm BaseAllele Name tm252
Gene Name mls-2
Sequence C39E6.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Liu: Development 132, 4119-4130 (2005). Dr. P. Sengupta: devective development of chemosensory neurons.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 20622/20623-T-21102/21103 (480 bp deletion + 1 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(20095..20257, 20304..20530, 20577..20665, 20719..20841, 22155..22390, 22447..22634))
Map position-7
Balancer
Map position of balancer
Sequence of primersExtFwd:GTCGGCCCTATCAAAGATGA,IntFwd:GTGAAGTACAATGACTACGAC,IntRev:CTCCGAATCTCAGAACACCC,ExtRev:AAACATGAGCAACCCAGGTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Godini R, Pocock R.
Characterization of the Doublesex/MAB-3 transcription factor DMD-9 in Caenorhabditis elegans.
G3 (Bethesda) 2023 13(2)  
[ PubMed ID = 36454093 ] [ RRC reference ]

Hsieh YW, Xiong R, Chuang CF.
Synergistic roles of homeodomain proteins UNC-62 homothorax and MLS-2 HMX/NKX in the specification of olfactory neurons in Caenorhabditis elegans.
Genetics 2021 219(2)  
[ PubMed ID = 34849889 ] [ RRC reference ]

Kim K, Kim R, Sengupta P.
The HMX/NKX homeodomain protein MLS-2 specifies the identity of the AWC sensory neuron type via regulation of the ceh-36 Otx gene in C. elegans.
Development 2010 137(6) 963-74 
[ PubMed ID = 20150279 ] [ RRC reference ]

Jiang Y, Horner V, Liu J.
The HMX homeodomain protein MLS-2 regulates cleavage orientation, cell proliferation and cell fate specification in the C. elegans postembryonic mesoderm.
Development 2005 132(18) 4119-30 
[ PubMed ID = 16107479 ] [ RRC reference ]