分離済み変異体

tm2504

Allele Nametm2504
BalanceCompleted
OutCrossNot Accepted
Sequence NameY57G11C.13
Gene Namearl-8
Worm BaseAllele Name tm2504 (x1)
Gene Name arl-8
Sequence Y57G11C.13
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 161377/161378-161657/161658 (280 bp deletion)
ChromosomeIV
Putative gene structurejoin(160907..161029, 161078..161465, 161513..161559)
Map position12.52
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtRev:ATTAGGCTGCAATGCTAGAG,IntRev:CATCCCACAGTGAAAGCTAC,ExtFwd:CTCGACTGGATTCGCAGTCT,IntFwd:CTTTAGAGCGGCCAATTCAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Fazeli G, Levin-Konigsberg R, Bassik MC, Stigloher C, Wehman AM.
A BORC-dependent molecular pathway for vesiculation of cell corpse phagolysosomes.
Curr Biol 2023 33(4) 607-621.e7 
[ PubMed ID = 36652947 ] [ RRC reference ]

Delahaye JL, Foster OK, Vine A, Saxton DS, Curtin TP, Somhegyi H, Salesky R, Hermann GJ.
Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1.
Mol Biol Cell 2014 25(7) 1073-96 
[ PubMed ID = 24501423 ] [ RRC reference ]

Sasaki A, Nakae I, Nagasawa M, Hashimoto K, Abe F, Saito K, Fukuyama M, Gengyo-Ando K, Mitani S, Katada T, Kontani K.
Arl8/ARL-8 functions in apoptotic cell removal by mediating phagolysosome formation in Caenorhabditis elegans.
Mol Biol Cell 2013 24(10) 1584-92 
[ PubMed ID = 23485564 ] [ RRC reference ]

Nakae I, Fujino T, Kobayashi T, Sasaki A, Kikko Y, Fukuyama M, Gengyo-Ando K, Mitani S, Kontani K, Katada T.
The arf-like GTPase Arl8 mediates delivery of endocytosed macromolecules to lysosomes in Caenorhabditis elegans.
Mol Biol Cell 2010 21(14) 2434-42 
[ PubMed ID = 20484575 ] [ RRC reference ]

Klassen MP, Wu YE, Maeder CI, Nakae I, Cueva JG, Lehrman EK, Tada M, Gengyo-Ando K, Wang GJ, Goodman M, Mitani S, Kontani K, Katada T, Shen K.
An Arf-like small G protein, ARL-8, promotes the axonal transport of presynaptic cargoes by suppressing vesicle aggregation.
Neuron 2010 66(5) 710-23 
[ PubMed ID = 20547129 ] [ RRC reference ]