Allele Name | tm2486 |
Allele Type | 通常株 |
Sequence Name | Y47H9C.6 |
Gene Name | csp-3 |
Worm Base | Allele Name |
tm2486
|
Gene Name |
csp-3
|
Sequence |
Y47H9C.6
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 58027/58028-58740/58741 (713 bp deletion) |
Chromosome | I |
Putative gene structure | complement(join(58017..58073, 58116..58352, 58397..58522)) |
Map position | 12.87 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:CGCCTCAAACGCCACTGGAT,IntRev:CGCCACTGGATTCTCTGGTA,IntFwd:ATTCATCGTAGCAGCGGGAA,ExtFwd:GCTAGCATGACATCGTCACA |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Jeong PY, Kumar A, Joshi PM, Rothman JH. Intertwined Functions of Separase and Caspase in Cell Division and Programmed Cell Death. Sci Rep 2020 10(1) 6159
[ PubMed ID = 32273538 ]
[ RRC reference ]
|
Huang CY, Chen JY, Wu SC, Tan CH, Tzeng RY, Lu PJ, Wu YF, Chen RH, Wu YC. C. elegans EIF-3.K promotes programmed cell death through CED-3 caspase. PLoS One 2012 7(5) e36584
[ PubMed ID = 22590572 ]
[ RRC reference ]
|
Geng X, Shi Y, Nakagawa A, Yoshina S, Mitani S, Shi Y, Xue D. Inhibition of CED-3 zymogen activation and apoptosis in Caenorhabditis elegans by caspase homolog CSP-3. Nat Struct Mol Biol 2008 15(10) 1094-101
[ PubMed ID = 18776901 ]
[ RRC reference ]
|
|