| Allele Name | tm2486 |
| Allele Type | 通常株 |
| Sequence Name | Y47H9C.6 |
| Gene Name | csp-3 |
| Worm Base | Allele Name |
tm2486
|
| Gene Name |
csp-3
|
| Sequence |
Y47H9C.6
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 58027/58028-58740/58741 (713 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(58017..58073, 58116..58352, 58397..58522)) |
| Map position | 12.87 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:CGCCTCAAACGCCACTGGAT,IntRev:CGCCACTGGATTCTCTGGTA,IntFwd:ATTCATCGTAGCAGCGGGAA,ExtFwd:GCTAGCATGACATCGTCACA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Jeong PY, Kumar A, Joshi PM, Rothman JH.
Intertwined Functions of Separase and Caspase in Cell Division and Programmed Cell Death.
Sci Rep 2020 10(1) 6159
[ PubMed ID = 32273538 ]
[ RRC reference ]
|
Huang CY, Chen JY, Wu SC, Tan CH, Tzeng RY, Lu PJ, Wu YF, Chen RH, Wu YC.
C. elegans EIF-3.K promotes programmed cell death through CED-3 caspase.
PLoS One 2012 7(5) e36584
[ PubMed ID = 22590572 ]
[ RRC reference ]
|
Geng X, Shi Y, Nakagawa A, Yoshina S, Mitani S, Shi Y, Xue D.
Inhibition of CED-3 zymogen activation and apoptosis in Caenorhabditis elegans by caspase homolog CSP-3.
Nat Struct Mol Biol 2008 15(10) 1094-101
[ PubMed ID = 18776901 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.