分離済み変異体

tm2484

Allele Nametm2484
BalanceNot Required
OutCrossNot Accepted
Sequence NameC06H5.7
Gene Namedcar-1
Worm BaseAllele Name tm2484
Gene Name dcar-1
Sequence C06H5.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 34337/34338-34561/34562 (224 bp deletion)
ChromosomeV
Putative gene structurejoin(30190..30258, 32442..32558, 32605..32732, 34092..34256, 34308..34643, 34836..34980, 36718..36948)
Map position13.33
Balancer
Map position of balancer
Sequence of primersIntRev:ACCAAGCCAATGCACCTTAA,IntFwd:CACAATGCGGAGATGTGTCA,ExtRev:CGGGTTCAGTACCAAGCCAA,ExtFwd:TGGTCAGCAATGGTGTCCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sonntag T, Omi S, Andreeva A, Valotteau C, Eichelbrenner J, Chisholm AD, Ward JD, Pujol N.
A defining member of the new cysteine-cradle family is an aECM protein signalling skin damage in C. elegans.
PLoS Genet 2025 21(3) e1011593 
[ PubMed ID = 40112269 ] [ RRC reference ]

Sonntag T, Omi S, Andreeva A, Eichelbrenner J, Chisholm AD, Ward JD, Pujol N.
A defining member of the new cysteine-cradle family is an aECM protein signalling skin damage in C. elegans.
bioRxiv 2024   
[ PubMed ID = 39574764 ] [ RRC reference ]

Liu P, Liu X, Qi B.
UPRER-immunity axis acts as physiological food evaluation system that promotes aversion behavior in sensing low-quality food.
Elife 2024 13  
[ PubMed ID = 39235964 ] [ RRC reference ]

Pop M, Klemke AL, Seidler L, Wernet N, Steudel PL, Baust V, Wohlmann E, Fischer R.
Caenorhabditis elegans neuropeptide NLP-27 enhances neurodegeneration and paralysis in an opioid-like manner during fungal infection.
iScience 2024 27(4) 109484 
[ PubMed ID = 38784855 ] [ RRC reference ]

Hodgkin J.
Nematode Autotomy Requires Molting and Entails Tissue Healing without Obvious Regeneration.
J Dev Biol 2019 7(4)  
[ PubMed ID = 31771156 ] [ RRC reference ]

Vérièpe J, Fossouo L, Parker JA.
Neurodegeneration in C. elegans models of ALS requires TIR-1/Sarm1 immune pathway activation in neurons.
Nat Commun 2015 6 7319 
[ PubMed ID = 26059317 ] [ RRC reference ]

Zugasti O, Bose N, Squiban B, Belougne J, Kurz CL, Schroeder FC, Pujol N, Ewbank JJ.
Activation of a G protein-coupled receptor by its endogenous ligand triggers the innate immune response of Caenorhabditis elegans.
Nat Immunol 2014 15(9) 833-8 
[ PubMed ID = 25086774 ] [ RRC reference ]

Aoki R, Yagami T, Sasakura H, Ogura K, Kajihara Y, Ibi M, Miyamae T, Nakamura F, Asakura T, Kanai Y, Misu Y, Iino Y, Ezcurra M, Schafer WR, Mori I, Goshima Y.
A seven-transmembrane receptor that mediates avoidance response to dihydrocaffeic acid, a water-soluble repellent in Caenorhabditis elegans.
J Neurosci 2011 31(46) 16603-10 
[ PubMed ID = 22090488 ] [ RRC reference ]