分離済み変異体

tm2482

Allele Nametm2482
BalanceNot Required
OutCrossNot Accepted
Sequence NameR74.3
Gene Namexbp-1
Worm BaseAllele Name tm2482
Gene Name xbp-1
Sequence R74.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10355/10356-10557/10558 (202 bp deletion)
ChromosomeIII
Putative gene structurejoin(10193..10372, 10423..10901, 10956..11091)
Map position-3.7
Balancer
Map position of balancer
Sequence of primersIntRev:CATACGACGGAGTTGGTTGC,IntFwd:TTATGTGCTCCCAGCACGCC,ExtFwd:GCCCCATATTCGCTACACTG,ExtRev:CATGTGGTTGCATAGAATCG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
He Y, Zhang Y, Xie H, Shan Z, Hou Z, Qi B.
The shutdown of food digestion due to endoplasmic reticulum homeostasis disruption acts as a protective mechanism in C. elegans.
Nat Commun 2025 16(1) 8417 
[ PubMed ID = 40998802 ] [ RRC reference ]

Rao R, Aballay A, Singh J.
Inhibition of the UFD-1-NPL-4 complex triggers an aberrant immune response in Caenorhabditis elegans.
Elife 2025 13  
[ PubMed ID = 40928215 ] [ RRC reference ]

Murley A, Popovici AC, Hu XS, Lund A, Wickham K, Durieux J, Joe L, Koronyo E, Zhang H, Genuth NR, Dillin A.
Quiescent cell re-entry is limited by macroautophagy-induced lysosomal damage.
Cell 2025 188(10) 2670-2686.e14 
[ PubMed ID = 40203825 ] [ RRC reference ]

Liu P, Liu X, Qi B.
UPRER-immunity axis acts as physiological food evaluation system that promotes aversion behavior in sensing low-quality food.
Elife 2024 13  
[ PubMed ID = 39235964 ] [ RRC reference ]

Taylor CA, Maor-Nof M, Metzl-Raz E, Hidalgo A, Yee C, Gitler AD, Shen K.
Histone deacetylase inhibition expands cellular proteostasis repertoires to enhance neuronal stress resilience.
bioRxiv 2024   
[ PubMed ID = 39229034 ] [ RRC reference ]

Xu J, Sabatino B, Yan J, Ermakova G, Doering KRS, Taubert S.
The unfolded protein response of the endoplasmic reticulum protects Caenorhabditis elegans against DNA damage caused by stalled replication forks.
G3 (Bethesda) 2024 14(4)  
[ PubMed ID = 38267027 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Ravi, Kumar A, Bhattacharyya S, Singh J.
Thiol reductive stress activates the hypoxia response pathway.
EMBO J 2023 42(22) e114093 
[ PubMed ID = 37902464 ] [ RRC reference ]

Li X, Li J, Zhu D, Zhang N, Hao X, Zhang W, Zhang Q, Liu Y, Wu X, Tian Y.
Protein disulfide isomerase PDI-6 regulates Wnt secretion to coordinate inter-tissue UPRmt activation and lifespan extension in C. elegans.
Cell Rep 2022 39(10) 110931 
[ PubMed ID = 35675782 ] [ RRC reference ]

Guan L, Zhan Z, Yang Y, Miao Y, Huang X, Ding M.
Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons.
PLoS Genet 2020 16(9) e1008704 
[ PubMed ID = 32986702 ] [ RRC reference ]

Tillman EJ, Richardson CE, Cattie DJ, Reddy KC, Lehrbach NJ, Droste R, Ruvkun G, Kim DH.
Endoplasmic Reticulum Homeostasis Is Modulated by the Forkhead Transcription Factor FKH-9 During Infection of Caenorhabditis elegans.
Genetics 2018 210(4) 1329-1337 
[ PubMed ID = 30287474 ] [ RRC reference ]

Cattie DJ, Richardson CE, Reddy KC, Ness-Cohn EM, Droste R, Thompson MK, Gilbert WV, Kim DH.
Mutations in Nonessential eIF3k and eIF3l Genes Confer Lifespan Extension and Enhanced Resistance to ER Stress in Caenorhabditis elegans.
PLoS Genet 2016 12(9) e1006326 
[ PubMed ID = 27690135 ] [ RRC reference ]

Truttmann MC, Cruz VE, Guo X, Engert C, Schwartz TU, Ploegh HL.
The Caenorhabditis elegans Protein FIC-1 Is an AMPylase That Covalently Modifies Heat-Shock 70 Family Proteins, Translation Elongation Factors and Histones.
PLoS Genet 2016 12(5) e1006023 
[ PubMed ID = 27138431 ] [ RRC reference ]

Wei X, Howell AS, Dong X, Taylor CA, Cooper RC, Zhang J, Zou W, Sherwood DR, Shen K.
The unfolded protein response is required for dendrite morphogenesis.
Elife 2015 4 e06963 
[ PubMed ID = 26052671 ] [ RRC reference ]

Asakura T, Ogura K, Goshima Y.
IRE-1/XBP-1 pathway of the unfolded protein response is required for properly localizing neuronal UNC-6/Netrin for axon guidance in C. elegans.
Genes Cells 2015 20(3) 153-9 
[ PubMed ID = 25469499 ] [ RRC reference ]

Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, Bülow HE, Henis-Korenblit S.
It's all in your mind: determining germ cell fate by neuronal IRE-1 in C. elegans.
PLoS Genet 2014 10(10) e1004747 
[ PubMed ID = 25340700 ] [ RRC reference ]

Kulalert W, Kim DH.
The unfolded protein response in a pair of sensory neurons promotes entry of C. elegans into dauer diapause.
Curr Biol 2013 23(24) 2540-5 
[ PubMed ID = 24316205 ] [ RRC reference ]

Richardson CE, Kinkel S, Kim DH.
Physiological IRE-1-XBP-1 and PEK-1 signaling in Caenorhabditis elegans larval development and immunity.
PLoS Genet 2011 7(11) e1002391 
[ PubMed ID = 22125500 ] [ RRC reference ]

Richardson CE, Kooistra T, Kim DH.
An essential role for XBP-1 in host protection against immune activation in C. elegans.
Nature 2010 463(7284) 1092-5 
[ PubMed ID = 20182512 ] [ RRC reference ]