分離済み変異体

tm2469

Allele Nametm2469
BalanceCompleted
OutCrossNot Accepted
Sequence NameR08C7.3
Gene Namehtz-1
Worm BaseAllele Name tm2469 (x1)
Gene Name htz-1
Sequence R08C7.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. W.G. Kelly: fertile and histone methylation on the male X chromosome is normal. Dr. H. Sawa: no Psa phenotype. Dr. M. Han: Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 25290/25291-25635/25636 (345 bp deletion)
ChromosomeIV
Putative gene structurejoin(25174..25343, 25394..25646)
Map position0.28
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtFwd:GCGTGCCAAAAAGGAGGAGT,IntFwd:GCGCGCTTTTGAGAGTTGAT,ExtRev:CGCCTATTGGGGAGTGATAG,IntRev:CCAGCATTTATTGTGGTCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Negishi T, Kitagawa S, Horii N, Tanaka Y, Haruta N, Sugimoto A, Sawa H, Hayashi KI, Harata M, Kanemaki MT.
The auxin-inducible degron 2 (AID2) system enables controlled protein knockdown during embryogenesis and development in Caenorhabditis elegans.
Genetics 2022 220(2)  
[ PubMed ID = 34865044 ] [ RRC reference ]

Shibata Y, Sawa H, Nishiwaki K.
HTZ-1/H2A.z and MYS-1/MYST HAT act redundantly to maintain cell fates in somatic gonadal cells through repression of ceh-22 in C. elegans.
Development 2014 141(1) 209-18 
[ PubMed ID = 24346701 ] [ RRC reference ]

Petty E, Laughlin E, Csankovszki G.
Regulation of DCC localization by HTZ-1/H2A.Z and DPY-30 does not correlate with H3K4 methylation levels.
PLoS One 2011 6(10) e25973 
[ PubMed ID = 21998734 ] [ RRC reference ]

Wagner CR, Kuervers L, Baillie DL, Yanowitz JL.
xnd-1 regulates the global recombination landscape in Caenorhabditis elegans.
Nature 2010 467(7317) 839-43 
[ PubMed ID = 20944745 ] [ RRC reference ]

Petty EL, Collette KS, Cohen AJ, Snyder MJ, Csankovszki G.
Restricting dosage compensation complex binding to the X chromosomes by H2A.Z/HTZ-1.
PLoS Genet 2009 5(10) e1000699 
[ PubMed ID = 19851459 ] [ RRC reference ]

Whittle CM, McClinic KN, Ercan S, Zhang X, Green RD, Kelly WG, Lieb JD.
The genomic distribution and function of histone variant HTZ-1 during C. elegans embryogenesis.
PLoS Genet 2008 4(9) e1000187 
[ PubMed ID = 18787694 ] [ RRC reference ]