分離済み変異体

tm2467

Allele Name

tm2467

Balance

Not Required

OutCross

Not Accepted

Sequence Name

Y51H4A.12

Gene Name

set-26

Worm Base

Allele Name

tm2467 (x1)

Gene Name

set-26

Sequence

Y51H4A.12

Phenotype

homozygous viable

Mutation site

178788/178789-179878/179875 (1090 bp deletion)

Chromosome

Putative gene structure

complement(join(175289..175332, 175464..175728, 176384..177177, 177711..177984, 178467..180302, 181241..182147, 183042..183382, 183470..183840, 183892..183997))

Map position

15.14

Balancer

nT1 [qIs51]

Map position of balancer

Sequence of primers

ExtRev:CCGCCGAACTTCCTCCTCAA,IntRev:AAGCCTCCGACGCTCCTCAT,IntFwd:TCGAATCGAAACCACGCCAG,ExtFwd:AAGACGAGACCCTGGCAATG

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Carvalho CA, Abu-Shach UB, Raju A, Vershinin Z, Levy D, Boxem M, Broday L.
SUMO-mediated regulation of H3K4me3 reader SET-26 controls germline development in C. elegans.
PLoS Biol 2025 23(1) e3002980
[ PubMed ID = 39761316 ] [ RRC reference ]

Emerson FJ, Chiu C, Lin LY, Riedel CG, Zhu M, Lee SS.
The chromatin factors SET-26 and HCF-1 oppose the histone deacetylase HDA-1 in longevity and gene regulation in C. elegans.
Nat Commun 2024 15(1) 2320
[ PubMed ID = 38485937 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Emerson FJ, Chiu C, Lin LY, Riedel CG, Zhu M, Lee SS.
The chromatin factors SET-26 and HCF-1 oppose the histone deacetylase HDA-1 in longevity and gene regulation in C. elegans.
bioRxiv 2023
[ PubMed ID = 36993207 ] [ RRC reference ]

Bazopoulou D, Knoefler D, Zheng Y, Ulrich K, Oleson BJ, Xie L, Kim M, Kaufmann A, Lee YT, Dou Y, Chen Y, Quan S, Jakob U.
Developmental ROS individualizes organismal stress resistance and lifespan.
Nature 2019 576(7786) 301-305
[ PubMed ID = 31801997 ] [ RRC reference ]

Hajduskova M, Baytek G, Kolundzic E, Gosdschan A, Kazmierczak M, Ofenbauer A, Beato Del Rosal ML, Herzog S, Ul Fatima N, Mertins P, Seelk-Müthel S, Tursun B.
MRG-1/MRG15 Is a Barrier for Germ Cell to Neuron Reprogramming in Caenorhabditis elegans.
Genetics 2019 211(1) 121-139
[ PubMed ID = 30425042 ] [ RRC reference ]

Wang W, Chaturbedi A, Wang M, An S, Santhi Velayudhan S, Lee SS.
SET-9 and SET-26 are H3K4me3 readers and play critical roles in germline development and longevity.
Elife 2018 7
[ PubMed ID = 29714684 ] [ RRC reference ]

Erdelyi P, Wang X, Suleski M, Wicky C.
A Network of Chromatin Factors Is Regulating the Transition to Postembryonic Development in Caenorhabditis elegans.
G3 (Bethesda) 2017 7(2) 343-353
[ PubMed ID = 28007841 ] [ RRC reference ]

Ni Z, Ebata A, Alipanahiramandi E, Lee SS.
Two SET domain containing genes link epigenetic changes and aging in Caenorhabditis elegans.
Aging Cell 2012 11(2) 315-25
[ PubMed ID = 22212395 ] [ RRC reference ]