| Allele Name | tm2466 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | D2013.1 |
| Gene Name | rab-39 |
| Worm Base | Allele Name |
tm2466
|
| Gene Name |
rab-39
|
| Sequence |
D2013.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. O. Blacque: dye-filling normal. Dr. S. Eimer: does not affect levamisole receptor trafficking. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 23001/23002-23190/23191 (189 bp deletion) |
| Chromosome | II |
| Putative gene structure | complement(join(22460..22603, 22653..22766, 22817..23006, 23060..23301)) |
| Map position | 1.16 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CGACTATGGACCGCTCTTTC,ExtFwd:TCGACGACGTCTCGATAAAC,IntFwd:CTTGGCAAAGTACTCGCCTT,ExtRev:CATTGGTGACGACTATGGAC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Takenaka M, Inoue H, Takeshima A, Kakura T, Hori T. C. elegans Rassf homolog, rasf-1, is functionally associated with rab-39 Rab GTPase in oxidative stress response. Genes Cells 2013 18(3) 203-10
[ PubMed ID = 23294242 ]
[ RRC reference ]
|
Sasidharan N, Sumakovic M, Hannemann M, Hegermann J, Liewald JF, Olendrowitz C, Koenig S, Grant BD, Rizzoli SO, Gottschalk A, Eimer S. RAB-5 and RAB-10 cooperate to regulate neuropeptide release in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2012 109(46) 18944-9
[ PubMed ID = 23100538 ]
[ RRC reference ]
|
|