分離済み変異体

tm2464

Allele Nametm2464
BalanceNot Required
OutCrossNot Accepted
Sequence NameB0395.2
Gene Namemboa-1
Worm BaseAllele Name tm2464
Gene Name mboa-1
Sequence B0395.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. T. Kurzchalia: non CDS mutant and does not affect the gene.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13665/13666-13867/13868 (202 bp deletion)
ChromosomeX
Putative gene structurejoin(11702..11844, 12296..12560, 13036..13152, 13197..13274, 13578..13657, 13870..14143, 14214..14529, 15427..15557)
Map position23.68
Balancer
Map position of balancer
Sequence of primersIntRev:AGTGTTCCACGCGGAACGGT,IntFwd:TGATTTCAGATCGACGCCTG,ExtRev:TCCCGTGTATGCAAACTGAC,ExtFwd:GGGACGGTAAGAATTCCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li Q, Zhou X, Zhang X, Zhang C, Zhang SO.
Nuclear receptor signaling regulates compartmentalized phosphatidylcholine remodeling to facilitate thermosensitive lipid droplet fusion.
Nat Commun 2025 16(1) 3955 
[ PubMed ID = 40289189 ] [ RRC reference ]

Guo A, Wu Q, Yan X, Chen K, Liu Y, Liang D, Yang Y, Luo Q, Xiong M, Yu Y, Fei E, Chen F.
Differential roles of lysosomal cholesterol transporters in the development of C. elegans NMJs.
Life Sci Alliance 2024 7(10)  
[ PubMed ID = 39084875 ] [ RRC reference ]