分離済み変異体

tm2452

Allele Nametm2452
Allele Type通常株
Sequence NameY38F2AL.2
Gene Namemksr-2
Worm BaseAllele Name tm2452
Gene Name mksr-2
Sequence Y38F2AL.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Oegema: non-Dyf.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13286/13287-13565/13566 (279 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(11916..12044, 13118..13302, 13348..13473, 13923..14010))
Map position-8.52
Balancer
Map position of balancer
Sequence of primersExtRev:GCTTGCATAGCACATAGGTT,IntRev:CGTCTGAGCGAACTTGCAAC,ExtFwd:TTGCTACCAACAGCCATAAG,IntFwd:TCCCTAATGGCTTTAGCGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
De-Castro ARG, Rodrigues DRM, De-Castro MJG, Vieira N, Vieira C, Carvalho AX, Gassmann R, Abreu CMC, Dantas TJ.
WDR60-mediated dynein-2 loading into cilia powers retrograde IFT and transition zone crossing.
J Cell Biol 2022 221(1)  
[ PubMed ID = 34739033 ] [ RRC reference ]

Lange KI, Tsiropoulou S, Kucharska K, Blacque OE.
Interpreting the pathogenicity of Joubert syndrome missense variants in Caenorhabditis elegans.
Dis Model Mech 2021 14(1)  
[ PubMed ID = 33234550 ] [ RRC reference ]

Masyukova SV, Landis DE, Henke SJ, Williams CL, Pieczynski JN, Roszczynialski KN, Covington JE, Malarkey EB, Yoder BK.
A Screen for Modifiers of Cilia Phenotypes Reveals Novel MKS Alleles and Uncovers a Specific Genetic Interaction between osm-3 and nphp-4.
PLoS Genet 2016 12(2) e1005841 
[ PubMed ID = 26863025 ] [ RRC reference ]

Jensen VL, Carter S, Sanders AA, Li C, Kennedy J, Timbers TA, Cai J, Scheidel N, Kennedy BN, Morin RD, Leroux MR, Blacque OE.
Whole-Organism Developmental Expression Profiling Identifies RAB-28 as a Novel Ciliary GTPase Associated with the BBSome and Intraflagellar Transport.
PLoS Genet 2016 12(12) e1006469 
[ PubMed ID = 27930654 ] [ RRC reference ]

Serwas D, Su TY, Roessler M, Wang S, Dammermann A.
Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans.
J Cell Biol 2017 216(6) 1659-1671 
[ PubMed ID = 28411189 ] [ RRC reference ]

Ohkura K, Bürglin TR.
Dye-filling of the amphid sheath glia: implications for the functional relationship between sensory neurons and glia in Caenorhabditis elegans.
Biochem Biophys Res Commun 2011 406(2) 188-93 
[ PubMed ID = 21295547 ] [ RRC reference ]

Warburton-Pitt SR, Jauregui AR, Li C, Wang J, Leroux MR, Barr MM.
Ciliogenesis in Caenorhabditis elegans requires genetic interactions between ciliary middle segment localized NPHP-2 (inversin) and transition zone-associated proteins.
J Cell Sci 2012 125(Pt 11) 2592-603 
[ PubMed ID = 22393243 ] [ RRC reference ]

Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P.
Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.
J Cell Sci 2013 126(Pt 19) 4381-95 
[ PubMed ID = 23886944 ] [ RRC reference ]

Masyukova SV, Winkelbauer ME, Williams CL, Pieczynski JN, Yoder BK.
Assessing the pathogenic potential of human Nephronophthisis disease-associated NPHP-4 missense mutations in C. elegans.
Hum Mol Genet 2011 20(15) 2942-54 
[ PubMed ID = 21546380 ] [ RRC reference ]

Huang L, Szymanska K, Jensen VL, Janecke AR, Innes AM, Davis EE, Frosk P, Li C, Willer JR, Chodirker BN, Greenberg CR, McLeod DR, Bernier FP, Chudley AE, Müller T, Shboul M, Logan CV, Loucks CM, Beaulieu CL, Bowie RV, Bell SM, Adkins J, Zuniga FI, Ross KD, Wang J, Ban MR, Becker C, Nürnberg P, Douglas S, Craft CM, Akimenko MA, Hegele RA, Ober C, Utermann G, Bolz HJ, Bulman DE, Katsanis N, Blacque OE, Doherty D, Parboosingh JS, Leroux MR, Johnson CA, Boycott KM.
TMEM237 is mutated in individuals with a Joubert syndrome related disorder and expands the role of the TMEM family at the ciliary transition zone.
Am J Hum Genet 2011 89(6) 713-30 
[ PubMed ID = 22152675 ] [ RRC reference ]

Cevik S, Sanders AA, Van Wijk E, Boldt K, Clarke L, van Reeuwijk J, Hori Y, Horn N, Hetterschijt L, Wdowicz A, Mullins A, Kida K, Kaplan OI, van Beersum SE, Man Wu K, Letteboer SJ, Mans DA, Katada T, Kontani K, Ueffing M, Roepman R, Kremer H, Blacque OE.
Active transport and diffusion barriers restrict Joubert Syndrome-associated ARL13B/ARL-13 to an Inv-like ciliary membrane subdomain.
PLoS Genet 2013 9(12) e1003977 
[ PubMed ID = 24339792 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84 
[ PubMed ID = 24646679 ] [ RRC reference ]

Yee LE, Garcia-Gonzalo FR, Bowie RV, Li C, Kennedy JK, Ashrafi K, Blacque OE, Leroux MR, Reiter JF.
Conserved Genetic Interactions between Ciliopathy Complexes Cooperatively Support Ciliogenesis and Ciliary Signaling.
PLoS Genet 2015 11(11) e1005627 
[ PubMed ID = 26540106 ] [ RRC reference ]

Bialas NJ, Inglis PN, Li C, Robinson JF, Parker JD, Healey MP, Davis EE, Inglis CD, Toivonen T, Cottell DC, Blacque OE, Quarmby LM, Katsanis N, Leroux MR.
Functional interactions between the ciliopathy-associated Meckel syndrome 1 (MKS1) protein and two novel MKS1-related (MKSR) proteins.
J Cell Sci 2009 122(Pt 5) 611-24 
[ PubMed ID = 19208769 ] [ RRC reference ]

Williams CL, Masyukova SV, Yoder BK.
Normal ciliogenesis requires synergy between the cystic kidney disease genes MKS-3 and NPHP-4.
J Am Soc Nephrol 2010 21(5) 782-93 
[ PubMed ID = 20150540 ] [ RRC reference ]

Williams CL, Winkelbauer ME, Schafer JC, Michaud EJ, Yoder BK.
Functional redundancy of the B9 proteins and nephrocystins in Caenorhabditis elegans ciliogenesis.
Mol Biol Cell 2008 19(5) 2154-68 
[ PubMed ID = 18337471 ] [ RRC reference ]