分離済み変異体

tm2443

Allele Nametm2443
BalanceNot Required
OutCrossNot Accepted
Sequence NameC33H5.15
Gene Namesgo-1
Worm BaseAllele Name tm2443
Gene Name sgo-1
Sequence C33H5.15
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Colaiacovo: Genes & Dev, 22, 2869 (2008). Dr. H. Sawa: not Psa.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 21762/21763-TTTTCTC-21966/21967 (204 bp deletion + 7 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(21369..21491, 21585..21775, 21830..22009, 22061..22284, 22339..22406, 22462..22529, 22577..22646))
Map position3.48
Balancer
Map position of balancer
Sequence of primersExtRev:GGTGTGTGGTCCGTGGTCAT,IntRev:GAGCGCCAACGATTCTCTTG,ExtFwd:AGGGCGGGAGTTGATGGCTT,IntFwd:CCTAGCCGTTGGCTTAGAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Reed R, Park K, Waddell B, Timbers TA, Li C, Baxi K, Giacomin RM, Leroux MR, Carvalho CE.
The Caenorhabditis elegans Shugoshin regulates TAC-1 in cilia.
Sci Rep 2023 13(1) 9410 
[ PubMed ID = 37296204 ] [ RRC reference ]

Reed R, Nyarko JNK, Mousseau DD, Egydio de Carvalho C.
A role for Shugoshin in human cilia?
MicroPubl Biol 2023 2023  
[ PubMed ID = 38152060 ] [ RRC reference ]

Labocha MK, Yuan W, Aleman-Meza B, Zhong W.
A strategy to apply quantitative epistasis analysis on developmental traits.
BMC Genet 2017 18(1) 42 
[ PubMed ID = 28506208 ] [ RRC reference ]

Kim T, Moyle MW, Lara-Gonzalez P, De Groot C, Oegema K, Desai A.
Kinetochore-localized BUB-1/BUB-3 complex promotes anaphase onset in C. elegans.
J Cell Biol 2015 209(4) 507-17 
[ PubMed ID = 25987605 ] [ RRC reference ]

Labocha MK, Jung SK, Aleman-Meza B, Liu Z, Zhong W.
WormGender - Open-Source Software for Automatic Caenorhabditis elegans Sex Ratio Measurement.
PLoS One 2015 10(9) e0139724 
[ PubMed ID = 26421844 ] [ RRC reference ]

de Carvalho CE, Zaaijer S, Smolikov S, Gu Y, Schumacher JM, Colaiácovo MP.
LAB-1 antagonizes the Aurora B kinase in C. elegans.
Genes Dev 2008 22(20) 2869-85 
[ PubMed ID = 18923084 ] [ RRC reference ]