分離済み変異体

tm2427

Allele Name

tm2427

Balance

Not Required

OutCross

Not Accepted

Sequence Name

F33D4.3

Gene Name

flp-13

Worm Base

Allele Name

tm2427

Gene Name

flp-13

Sequence

F33D4.3

Phenotype

homozygous viable. Dr. O. Hobert: wild-type chemotaxis to NaCl, NH4Ac and L-leucine. Dr. Y. Jin: normal movement, motor axons are normal, grow well.

Mutation site

22647/22648-23027/23028 (380 bp deletion)

Chromosome

Putative gene structure

complement(join(22232..22424, 22750..22951, 23354..23441))

Map position

3.39

Balancer

Map position of balancer

Sequence of primers

ExtRev:GTCGCCATTCAGGCCTTTGA,IntRev:GGATCCATTTCTCCTGACTT,ExtFwd:GTAGACACACAATCGTCGAC,IntFwd:CGTCGACTAAATGAGATCCA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Rossi L, Amoako K, Busack I, Golinelli L, Courtney A, Besseling J, Schafer W, Beets I, Bringmann H.
The neuropeptide FLP-11 induces and self-inhibits sleep through the receptor DMSR-1 in Caenorhabiditis elegans.
Curr Biol 2025 35(9) 2183-2194.e10
[ PubMed ID = 40273913 ] [ RRC reference ]

Wang PZ, Ge MH, Su P, Wu PP, Wang L, Zhu W, Li R, Liu H, Wu JJ, Xu Y, Zhao JL, Li SJ, Wang Y, Chen LM, Wu TH, Wu ZX.
Sensory plasticity caused by up-down regulation encodes the information of short-term learning and memory.
iScience 2025 28(4) 112215
[ PubMed ID = 40224011 ] [ RRC reference ]

Pradhan S, Madan GK, Kang D, Bueno E, Atanas AA, Kramer TS, Dag U, Lage JD, Gomes MA, Lu AK, Park J, Flavell SW.
Pathogen infection induces sickness behaviors through neuromodulators linked to stress and satiety in C. elegans.
Nat Commun 2025 16(1) 3200
[ PubMed ID = 40180949 ] [ RRC reference ]

Levi-Ferber M, Shalash R, Le-Thomas A, Salzberg Y, Shurgi M, Benichou JI, Ashkenazi A, Henis-Korenblit S.
Neuronal regulated ire-1-dependent mRNA decay controls germline differentiation in Caenorhabditis elegans.
Elife 2021 10
[ PubMed ID = 34477553 ] [ RRC reference ]

Lee JS, Shih PY, Schaedel ON, Quintero-Cadena P, Rogers AK, Sternberg PW.
FMRFamide-like peptides expand the behavioral repertoire of a densely connected nervous system.
Proc Natl Acad Sci U S A 2017 114(50) E10726-E10735
[ PubMed ID = 29167374 ] [ RRC reference ]

Takahashi M, Takagi S.
Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans.
PLoS Genet 2017 13(12) e1007134
[ PubMed ID = 29281635 ] [ RRC reference ]

DeBardeleben HK, Lopes LE, Nessel MP, Raizen DM.
Stress-Induced Sleep After Exposure to Ultraviolet Light Is Promoted by p53 in Caenorhabditis elegans.
Genetics 2017 207(2) 571-582
[ PubMed ID = 28754659 ] [ RRC reference ]

Iannacone MJ, Beets I, Lopes LE, Churgin MA, Fang-Yen C, Nelson MD, Schoofs L, Raizen DM.
The RFamide receptor DMSR-1 regulates stress-induced sleep in C. elegans.
Elife 2017 6
[ PubMed ID = 28094002 ] [ RRC reference ]

Nath RD, Chow ES, Wang H, Schwarz EM, Sternberg PW.
C. elegans Stress-Induced Sleep Emerges from the Collective Action of Multiple Neuropeptides.
Curr Biol 2016 26(18) 2446-2455
[ PubMed ID = 27546573 ] [ RRC reference ]

Trojanowski NF, Nelson MD, Flavell SW, Fang-Yen C, Raizen DM.
Distinct Mechanisms Underlie Quiescence during Two Caenorhabditis elegans Sleep-Like States.
J Neurosci 2015 35(43) 14571-84
[ PubMed ID = 26511247 ] [ RRC reference ]

Nelson MD, Lee KH, Churgin MA, Hill AJ, Van Buskirk C, Fang-Yen C, Raizen DM.
FMRFamide-like FLP-13 neuropeptides promote quiescence following heat stress in Caenorhabditis elegans.
Curr Biol 2014 24(20) 2406-10
[ PubMed ID = 25264253 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9
[ PubMed ID = 23852451 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet 2013 9(5) e1003472
[ PubMed ID = 23658528 ] [ RRC reference ]