分離済み変異体

tm2423

Allele Nametm2423
BalanceNot Required
OutCrossNot Accepted
Sequence NameY37A1B.2
Gene Namelst-4
Worm BaseAllele Name tm2423
Gene Name lst-4
Sequence Y37A1B.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Blacque: dye-filling normal. Dr.M. Hengartner: degradation of apoptotic cells in the germline is impaired.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 89961/89962-90173/90174 (212 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(88215..88448, 89008..89174, 89234..89311, 89367..89470, 89536..89870, 89917..90273, 93654..93875, 95893..95994, 96601..96696))
Map position11.3
Balancer
Map position of balancer
Sequence of primersExtFwd:GCACTGGTTCCATGTCATTC,IntRev:GTAGCCACTCGGAACACGGT,ExtRev:TGACCTCAGCCGTAGCCACT,IntFwd:CTTCGTGTGCGCATCGAATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Tian Y, Kang Q, Shi X, Wang Y, Zhang N, Ye H, Xu Q, Xu T, Zhang R.
SNX-3 mediates retromer-independent tubular endosomal recycling by opposing EEA-1-facilitated trafficking.
PLoS Genet 2021 17(6) e1009607 
[ PubMed ID = 34081703 ] [ RRC reference ]

Jenzer C, Simionato E, Largeau C, Scarcelli V, Lefebvre C, Legouis R.
Autophagy mediates phosphatidylserine exposure and phagosome degradation during apoptosis through specific functions of GABARAP/LGG-1 and LC3/LGG-2.
Autophagy 2019 15(2) 228-241 
[ PubMed ID = 30160610 ] [ RRC reference ]

Vieira N, Bessa C, Rodrigues AJ, Marques P, Chan FY, de Carvalho AX, Correia-Neves M, Sousa N.
Sorting nexin 3 mutation impairs development and neuronal function in Caenorhabditis elegans.
Cell Mol Life Sci 2018 75(11) 2027-2044 
[ PubMed ID = 29196797 ] [ RRC reference ]

Ghose P, Rashid A, Insley P, Trivedi M, Shah P, Singhal A, Lu Y, Bao Z, Shaham S.
EFF-1 fusogen promotes phagosome sealing during cell process clearance in Caenorhabditis elegans.
Nat Cell Biol 2018 20(4) 393-399 
[ PubMed ID = 29556089 ] [ RRC reference ]

Cheng S, Wang K, Zou W, Miao R, Huang Y, Wang H, Wang X.
PtdIns(4,5)P₂ and PtdIns3P coordinate to regulate phagosomal sealing for apoptotic cell clearance.
J Cell Biol 2015 210(3) 485-502 
[ PubMed ID = 26240185 ] [ RRC reference ]

Xu M, Liu Y, Zhao L, Gan Q, Wang X, Yang C.
The lysosomal cathepsin protease CPL-1 plays a leading role in phagosomal degradation of apoptotic cells in Caenorhabditis elegans.
Mol Biol Cell 2014 25(13) 2071-83 
[ PubMed ID = 24829385 ] [ RRC reference ]

Norris AD, Gao S, Norris ML, Ray D, Ramani AK, Fraser AG, Morris Q, Hughes TR, Zhen M, Calarco JA.
A pair of RNA-binding proteins controls networks of splicing events contributing to specialization of neural cell types.
Mol Cell 2014 54(6) 946-959 
[ PubMed ID = 24910101 ] [ RRC reference ]

Chen D, Jian Y, Liu X, Zhang Y, Liang J, Qi X, Du H, Zou W, Chen L, Chai Y, Ou G, Miao L, Wang Y, Yang C.
Clathrin and AP2 are required for phagocytic receptor-mediated apoptotic cell clearance in Caenorhabditis elegans.
PLoS Genet 2013 9(5) e1003517 
[ PubMed ID = 23696751 ] [ RRC reference ]

Oikonomou G, Perens EA, Lu Y, Shaham S.
Some, but not all, retromer components promote morphogenesis of C. elegans sensory compartments.
Dev Biol 2012 362(1) 42-9 
[ PubMed ID = 22138055 ] [ RRC reference ]

Almendinger J, Doukoumetzidis K, Kinchen JM, Kaech A, Ravichandran KS, Hengartner MO.
A conserved role for SNX9-family members in the regulation of phagosome maturation during engulfment of apoptotic cells.
PLoS One 2011 6(4) e18325 
[ PubMed ID = 21494661 ] [ RRC reference ]

Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z.
Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling.
Mol Biol Cell 2011 22(3) 354-74 
[ PubMed ID = 21148288 ] [ RRC reference ]

Chen D, Xiao H, Zhang K, Wang B, Gao Z, Jian Y, Qi X, Sun J, Miao L, Yang C.
Retromer is required for apoptotic cell clearance by phagocytic receptor recycling.
Science 2010 327(5970) 1261-4 
[ PubMed ID = 20133524 ] [ RRC reference ]