分離済み変異体

tm2416

Allele Name

tm2416

Allele Type

通常株

Sequence Name

ZK84.6

Gene Name

ins-6

Worm Base

Allele Name

tm2416

Gene Name

ins-6

Sequence

ZK84.6

Phenotype

homozygous viable. Dr. K. Ashrafi: slightly increased Nile Red staining. Dr. M. Driscoll: normal dauer formation. Dr. P.W. Sternberg: slow locomotion. Dr. J. Kaplan: normal nile red staining. Dr. Q.L. Ch'ng: non-Unc, non-Pvl, non-Lon, non-Sma, non-Dpy.

Mutation site

4004/4005-4320/4321 (316 bp deletion)

Chromosome

Putative gene structure

join(4009..4267, 4322..4401)

Map position

-0.7

Balancer

Map position of balancer

Sequence of primers

ExtRev:TTGTACAAGCCACTGGGATG,IntRev:ACAGAGACTGATATCGGAGT,ExtFwd:TTTACCCACCCCTTCGTGAT,IntFwd:TCGTGATGCTCCGCCTATTG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Zhang MG, Seyedolmohadesin M, Mercado SH, Tauffenberger A, Park H, Finnen N, Schroeder FC, Venkatachalam V, Sternberg PW.
Sensory integration of food and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(40) e2405391121
[ PubMed ID = 39316052 ] [ RRC reference ]

Zhang MG, Seyedolmohadesin M, Hawk S, Park H, Finnen N, Schroeder F, Venkatachalam V, Sternberg PW.
Sensory integration of food availability and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans.
bioRxiv 2024
[ PubMed ID = 38586049 ] [ RRC reference ]

Mishra S, Dabaja M, Akhlaq A, Pereira B, Marbach K, Rovcanin M, Chandra R, Caballero A, Fernandes de Abreu D, Ch'ng Q, Alcedo J.
Specific sensory neurons and insulin-like peptides modulate food type-dependent oogenesis and fertilization in Caenorhabditis elegans.
Elife 2023 12
[ PubMed ID = 37975568 ] [ RRC reference ]

Banerjee N, Rojas Palato EJ, Shih PY, Sternberg PW, Hallem EA.
Distinct neurogenetic mechanisms establish the same chemosensory valence state at different life stages in Caenorhabditis elegans.
G3 (Bethesda) 2024 14(2)
[ PubMed ID = 38092065 ] [ RRC reference ]

Tang LTH, Lee GA, Cook SJ, Ho J, Potter CC, Bülow HE.
Anatomical restructuring of a lateralized neural circuit during associative learning by asymmetric insulin signaling.
Curr Biol 2023 33(18) 3835-3850.e6
[ PubMed ID = 37591249 ] [ RRC reference ]

Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178
[ PubMed ID = 35511794 ] [ RRC reference ]

Schiffer JA, Servello FA, Heath WR, Amrit FRG, Stumbur SV, Eder M, Martin OM, Johnsen SB, Stanley JA, Tam H, Brennan SJ, McGowan NG, Vogelaar AL, Xu Y, Serkin WT, Ghazi A, Stroustrup N, Apfeld J.
Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies.
Elife 2020 9
[ PubMed ID = 32367802 ] [ RRC reference ]

McCulloch KA, Zhou K, Jin Y.
Neuronal transcriptome analyses reveal novel neuropeptide modulators of excitation and inhibition imbalance in C. elegans.
PLoS One 2020 15(6) e0233991
[ PubMed ID = 32497060 ] [ RRC reference ]

Wu T, Duan F, Yang W, Liu H, Caballero A, Fernandes de Abreu DA, Dar AR, Alcedo J, Ch'ng Q, Butcher RA, Zhang Y.
Pheromones Modulate Learning by Regulating the Balanced Signals of Two Insulin-like Peptides.
Neuron 2019 104(6) 1095-1109.e5
[ PubMed ID = 31676170 ] [ RRC reference ]

Kaplan REW, Maxwell CS, Codd NK, Baugh LR.
Pervasive Positive and Negative Feedback Regulation of Insulin-Like Signaling in Caenorhabditis elegans.
Genetics 2019 211(1) 349-361
[ PubMed ID = 30425043 ] [ RRC reference ]

Harris G, Wu T, Linfield G, Choi MK, Liu H, Zhang Y.
Molecular and cellular modulators for multisensory integration in C. elegans.
PLoS Genet 2019 15(3) e1007706
[ PubMed ID = 30849079 ] [ RRC reference ]

Burton NO, Furuta T, Webster AK, Kaplan RE, Baugh LR, Arur S, Horvitz HR.
Insulin-like signalling to the maternal germline controls progeny response to osmotic stress.
Nat Cell Biol 2017 19(3) 252-257
[ PubMed ID = 28166192 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2017 484(2) 323-330
[ PubMed ID = 28131836 ] [ RRC reference ]

Reis Rodrigues P, Kaul TK, Ho JH, Lucanic M, Burkewitz K, Mair WB, Held JM, Bohn LM, Gill MS.
Synthetic Ligands of Cannabinoid Receptors Affect Dauer Formation in the Nematode Caenorhabditis elegans.
G3 (Bethesda) 2016 6(6) 1695-705
[ PubMed ID = 27172180 ] [ RRC reference ]

Lee K, Mylonakis E.
An Intestine-Derived Neuropeptide Controls Avoidance Behavior in Caenorhabditis elegans.
Cell Rep 2017 20(10) 2501-2512
[ PubMed ID = 28877481 ] [ RRC reference ]

Guillermin ML, Carrillo MA, Hallem EA.
A Single Set of Interneurons Drives Opposite Behaviors in C. elegans.
Curr Biol 2017 27(17) 2630-2639.e6
[ PubMed ID = 28823678 ] [ RRC reference ]

Baugh LR, Kurhanewicz N, Sternberg PW.
Sensitive and precise quantification of insulin-like mRNA expression in Caenorhabditis elegans.
PLoS One 2011 6(3) e18086
[ PubMed ID = 21445366 ] [ RRC reference ]

Chen Z, Hendricks M, Cornils A, Maier W, Alcedo J, Zhang Y.
Two insulin-like peptides antagonistically regulate aversive olfactory learning in C. elegans.
Neuron 2013 77(3) 572-85
[ PubMed ID = 23395381 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc Natl Acad Sci U S A 2013 110(29) 11940-5
[ PubMed ID = 23818641 ] [ RRC reference ]

Kaul TK, Reis Rodrigues P, Ogungbe IV, Kapahi P, Gill MS.
Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.
PLoS One 2014 9(1) e86979
[ PubMed ID = 24475206 ] [ RRC reference ]