Home > 分離済み変異体 > tm2411

分離済み変異体

Allele Name		tm2411
Allele Type		通常株
Sequence Name		T01A4.1b
Gene Name		gcy-28
Worm Base	Allele Name	tm2411
	Gene Name	gcy-28
	Sequence	T01A4.1b
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. C. Bargmann: chemotaxis-defective to AWC odors, sensitive to osmotic stress. Dr. L. Avery: intact satiety behavior. Dr. T. Ishihara: defective in sensory integration and salt chemotaxis learning. Dr. I. Mori: weakly thermophilic.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		40946/40947-41648/41649 (702 bp deletion)
Chromosome		I
Putative gene structure		join(38759..39049, 39420..39619, 40575..40719, 40788..40959, 41212..41367, 41872..42188, 42818..43055, 43302..43460, 43634..43869)
Map position		-1.17
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CCCAGTCCTGATTACGACTC,ExtRev:TCTTGCGTGCGTTCCTCAAC,IntFwd:TCACCGGAGCATGTATCGAT,IntRev:GCGTTCCTCAACAAGACCTT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Cheng D, Lee JS, Brown M, Ebert MS, McGrath PT, Tomioka M, Iino Y, Bargmann CI. Insulin/IGF signaling regulates presynaptic glutamate release in aversive olfactory learning. Cell Rep 2022 41(8) 111685  [ PubMed ID = 36417877 ] [ RRC reference ] Kang C, Avery L. The FMRFamide Neuropeptide FLP-20 Acts as a Systemic Signal for Starvation Responses in Caenorhabditis elegans. Mol Cells 2021 44(7) 529-537  [ PubMed ID = 34140426 ] [ RRC reference ] Arey RN, Stein GM, Kaletsky R, Kauffman A, Murphy CT. Activation of Gαq Signaling Enhances Memory Consolidation and Slows Cognitive Decline. Neuron 2018 98(3) 562-574.e5  [ PubMed ID = 29656871 ] [ RRC reference ] Shinkai Y, Yamamoto Y, Fujiwara M, Tabata T, Murayama T, Hirotsu T, Ikeda DD, Tsunozaki M, Iino Y, Bargmann CI, Katsura I, Ishihara T. Behavioral choice between conflicting alternatives is regulated by a receptor guanylyl cyclase, GCY-28, and a receptor tyrosine kinase, SCD-2, in AIA interneurons of Caenorhabditis elegans. J Neurosci 2011 31(8) 3007-15  [ PubMed ID = 21414922 ] [ RRC reference ] Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N. Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans. Proc Natl Acad Sci U S A 2011 108(1) 254-9  [ PubMed ID = 21173231 ] [ RRC reference ] Uozumi T, Hirotsu T, Yoshida K, Yamada R, Suzuki A, Taniguchi G, Iino Y, Ishihara T. Temporally-regulated quick activation and inactivation of Ras is important for olfactory behaviour. Sci Rep 2012 2 500  [ PubMed ID = 22787558 ] [ RRC reference ] Nishio N, Mohri-Shiomi A, Nishida Y, Hiramatsu N, Kodama-Namba E, Kimura KD, Kuhara A, Mori I. A novel and conserved protein AHO-3 is required for thermotactic plasticity associated with feeding states in Caenorhabditis elegans. Genes Cells 2012 17(5) 365-86  [ PubMed ID = 22512337 ] [ RRC reference ] Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M. Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans. PLoS Genet 2011 7(10) e1002335  [ PubMed ID = 22022287 ] [ RRC reference ] Tsunozaki M, Chalasani SH, Bargmann CI. A behavioral switch: cGMP and PKC signaling in olfactory neurons reverses odor preference in C. elegans. Neuron 2008 59(6) 959-71  [ PubMed ID = 18817734 ] [ RRC reference ]