Allele Name | tm2409 |
Allele Type | 通常株 |
Sequence Name | Y111B2A.26 |
Gene Name | snx-13 |
Worm Base | Allele Name |
tm2409
|
Gene Name |
snx-13
|
Sequence |
Y111B2A.26
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. G. Jansen: normal dye filling. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 31142/31143-31317/31318 (175 bp deletion) |
Chromosome | IV |
Putative gene structure | join(27216..27458, 29462..29713, 30863..30986, 31229..31413, 33354..33478, 34228..34335, 34852..34930) |
Map position | 16.13 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:CGCGCAAATTCGTGAAGACC,IntFwd:CGTGAAGACCTTGACCGCCA,ExtRev:TTCGGAGTGCCTTGGGGAGT,IntRev:CTTGGGGAGTTTCGGCAAAT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
van der Vaart A, Rademakers S, Jansen G. DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans. PLoS Genet 2015 11(12) e1005733
[ PubMed ID = 26657059 ]
[ RRC reference ]
|
Broekhuis JR, Rademakers S, Burghoorn J, Jansen G. SQL-1, homologue of the Golgi protein GMAP210, modulates intraflagellar transport in C. elegans. J Cell Sci 2013 126(Pt 8) 1785-95
[ PubMed ID = 23444385 ]
[ RRC reference ]
|
|