Allele Name | tm2398 |
Allele Type | 通常株 |
Sequence Name | Y22F5A.5 |
Gene Name | lys-2 |
Worm Base | Allele Name |
tm2398
|
Gene Name |
lys-2
|
Sequence |
Y22F5A.5
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. M. Herman: life span change by some bacteria. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 26508/26509-26958/26959 (450 bp deletion) |
Chromosome | V |
Putative gene structure | complement(join(26287..26700, 26938..27363)) |
Map position | 2.45 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:CAGAGAGTCTGCACTGGTAT,IntRev:AGACCACAAGAAATCGACTC,ExtFwd:TTACCCGCGTGGAAGGCTTG,IntFwd:CACCATCTGCCATATTGACT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Radeke LJ, Herman MA. Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia. BMC Microbiol 2020 20(1) 170
[ PubMed ID = 32560629 ]
[ RRC reference ]
|
Boehnisch C, Wong D, Habig M, Isermann K, Michiels NK, Roeder T, May RC, Schulenburg H. Protist-type lysozymes of the nematode Caenorhabditis elegans contribute to resistance against pathogenic Bacillus thuringiensis. PLoS One 2011 6(9) e24619
[ PubMed ID = 21931778 ]
[ RRC reference ]
|
|