| Allele Name | tm2395 |
| Balance | Request Available |
| OutCross | Not Accepted |
| Sequence Name | C07A9.3 |
| Gene Name | tlk-1 |
| Worm Base | Allele Name |
tm2395
(x1) |
| Gene Name |
tlk-1
|
| Sequence |
C07A9.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr.J.M. Schumacher: Ste. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 44263/44264-44941/44942 (678 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(34657..34941, 35031..35224, 35545..35555, 36082..36235, 36955..37007, 37134..37375, 42123..42227, 42870..43190, 43241..43464, 43974..44454, 44514..45944, 45995..46105, 46571..46654) |
| Map position | 0.91 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GTCGACAGCCACTGACAAGA,IntFwd:GCGACGAAAAGCTGGTCCAA,ExtRev:GTACTGCAGGCATCTTCTTA,IntRev:GCGGAGCTCACCTAAAACAG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Yang X, Wei R, Meng F, Liu D, Gong X, Ruvkun G, Wei W.
Mitochondrial fission surveillance is coupled to Caenorhabditis elegans DNA and chromosome segregation integrity.
PLoS Genet 2025 21(4) e1011678
[ PubMed ID = 40279356 ]
[ RRC reference ]
|
Yeh CH, Yang HJ, Lee IJ, Wu YC.
Caenorhabditis elegans TLK-1 controls cytokinesis by localizing AIR-2/Aurora B to midzone microtubules.
Biochem Biophys Res Commun 2010 400(2) 187-93
[ PubMed ID = 20705056 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.