分離済み変異体

tm2394

Allele Nametm2394
BalanceNot Required
OutCrossNot Accepted
Sequence NameC18H9.8
Gene Nameift-74
Worm BaseAllele Name tm2394
Gene Name ift-74
Sequence C18H9.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. Mitani: Genes to Cells 12, 593 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2746/2747-TTCCACTGTTTC-3062/3063 (316 bp deletion + 12 bp insertion)
ChromosomeII
Putative gene structurejoin(2396..2464, 2519..2595, 2649..2743, 2823..3004, 3163..3268, 3318..3604, 3659..4166, 4614..4859, 4912..5189, 5241..5351, 5400..5465)
Map position-0.04
Balancer
Map position of balancer
Sequence of primersExtFwd:AGCTGCTGGTGTAGGACATG,IntFwd:GCTGACAAACCAGAATGGTC,ExtRev:CAATCCGGCTGTTGGAGGTC,IntRev:AGTCATTGGGCGTCCACCCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hao L, Thein M, Brust-Mascher I, Civelekoglu-Scholey G, Lu Y, Acar S, Prevo B, Shaham S, Scholey JM.
Intraflagellar transport delivers tubulin isotypes to sensory cilium middle and distal segments.
Nat Cell Biol 2011 13(7) 790-8 
[ PubMed ID = 21642982 ] [ RRC reference ]

Kobayashi T, Gengyo-Ando K, Ishihara T, Katsura I, Mitani S.
IFT-81 and IFT-74 are required for intraflagellar transport in C. elegans.
Genes Cells 2007 12(5) 593-602 
[ PubMed ID = 17535250 ] [ RRC reference ]