分離済み変異体

tm2363

Allele Nametm2363
BalanceNot Required
OutCrossNot Accepted
Sequence NameC46H11.11
Gene Namefhod-1
Worm BaseAllele Name tm2363
Gene Name fhod-1
Sequence C46H11.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 40271/40272-CNANCCTCAC-40648/40649 (377 bp deletion + 10 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(38868..38923, 39048..39167, 39213..39677, 39729..40434, 40486..40775, 41022..41358, 41405..41533, 41616..41742, 41858..41945, 43617..43851, 44442..44642, 44856..44923, 45478..45536, 48449..48623, 48944..49076))
Map position-0.42
Balancer
Map position of balancer
Sequence of primersExtFwd:TGGCCAAAAGCATTCCCATC,IntFwd:TGCATATCCATAAGGGGCTC,ExtRev:CAATCCCAGTGGGCTGCCAT,IntRev:CAGTGATATTGGAGCCGCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kimmich MJ, Geary MA, Mi-Mi L, Votra SD, Pellenz CD, Sundaramurthy S, Pruyne D.
The sole essential low molecular weight tropomyosin isoform of Caenorhabditis elegans is essential for pharyngeal muscle function.
bioRxiv 2024   
[ PubMed ID = 39764053 ] [ RRC reference ]

Kimmich MJ, Sundaramurthy S, Geary MA, Lesanpezeshki L, Yingling CV, Vanapalli SA, Littlefield RS, Pruyne D.
FHOD-1 and profilin protect sarcomeres against contraction-induced deformation> in C. elegans.
Mol Biol Cell 2024 35(11) ar137 
[ PubMed ID = 39259762 ] [ RRC reference ]

Kimmich MJ, Sundaramurthy S, Geary MA, Lesanpezeshki L, Yingling CV, Vanapalli SA, Littlefield RS, Pruyne D.
FHOD-1/profilin-mediated actin assembly protects sarcomeres against contraction-induced deformation in C. elegans.
bioRxiv 2024   
[ PubMed ID = 38559004 ] [ RRC reference ]

Drewnik ED, Wiesenfahrt T, Smit RB, Park YJ, Pallotto LM, Mains PE.
Tissue-specific regulation of epidermal contraction during Caenorhabditis elegans embryonic morphogenesis.
G3 (Bethesda) 2021 11(7)  
[ PubMed ID = 33974063 ] [ RRC reference ]

Lardennois A, Pásti G, Ferraro T, Llense F, Mahou P, Pontabry J, Rodriguez D, Kim S, Ono S, Beaurepaire E, Gally C, Labouesse M.
An actin-based viscoplastic lock ensures progressive body-axis elongation.
Nature 2019 573(7773) 266-270 
[ PubMed ID = 31462781 ] [ RRC reference ]

Refai O, Smit RB, Votra S, Pruyne D, Mains PE.
Tissue-Specific Functions of fem-2/PP2c Phosphatase and fhod-1/formin During Caenorhabditis elegans Embryonic Morphogenesis.
G3 (Bethesda) 2018 8(7) 2277-2290 
[ PubMed ID = 29720391 ] [ RRC reference ]

Hegsted A, Wright FA, Votra S, Pruyne D.
INF2- and FHOD-related formins promote ovulation in the somatic gonad of C. elegans.
Cytoskeleton (Hoboken) 2016 73(12) 712-728 
[ PubMed ID = 27770600 ] [ RRC reference ]

Mi-Mi L, Pruyne D.
Loss of Sarcomere-associated Formins Disrupts Z-line Organization, but does not Prevent Thin Filament Assembly in Caenorhabditis elegans Muscle.
J Cytol Histol 2015 6(2)  
[ PubMed ID = 26161293 ] [ RRC reference ]

Vanneste CA, Pruyne D, Mains PE.
The role of the formin gene fhod-1 in C. elegans embryonic morphogenesis.
Worm 2013 2(3) e25040 
[ PubMed ID = 24778933 ] [ RRC reference ]

Mi-Mi L, Votra S, Kemphues K, Bretscher A, Pruyne D.
Z-line formins promote contractile lattice growth and maintenance in striated muscles of C. elegans.
J Cell Biol 2012 198(1) 87-102 
[ PubMed ID = 22753896 ] [ RRC reference ]