分離済み変異体

tm2355

Allele Nametm2355
BalanceNot Required
OutCrossNot Accepted
Sequence NameF32A6.2
Gene Nameift-81
Worm BaseAllele Name tm2355
Gene Name ift-81
Sequence F32A6.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. Mitani: Genes to Cells 12, 593 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15745/15746-TTTTTTCTTT-16095/16096 (340 bp deletion)
ChromosomeX
Putative gene structurejoin(13454..13584, 14178..14297, 14355..14478, 14751..14831, 14919..15073, 15838..15922, 16160..16378)
Map position-5.73
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCCTGTATCGGTATTGCTT ,ExtRev:CGCACTGAATTGGACCTTGC ,IntFwd:GCTATGCAAGTGCAGATAGA ,IntRev:GGCTGTCAGCTCTTTCAACT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Turan MG, Kantarci H, Cevik S, Kaplan OI.
ARL13B regulates juxtaposed cilia-cilia elongation in BBSome dependent manner in Caenorhabditis elegans.
iScience 2025 28(2) 111791 
[ PubMed ID = 39925426 ] [ RRC reference ]

Maurya AK, Rogers T, Sengupta P.
A CCRK and a MAK Kinase Modulate Cilia Branching and Length via Regulation of Axonemal Microtubule Dynamics in Caenorhabditis elegans.
Curr Biol 2019 29(8) 1286-1300.e4 
[ PubMed ID = 30955935 ] [ RRC reference ]

Hao L, Thein M, Brust-Mascher I, Civelekoglu-Scholey G, Lu Y, Acar S, Prevo B, Shaham S, Scholey JM.
Intraflagellar transport delivers tubulin isotypes to sensory cilium middle and distal segments.
Nat Cell Biol 2011 13(7) 790-8 
[ PubMed ID = 21642982 ] [ RRC reference ]

Kobayashi T, Gengyo-Ando K, Ishihara T, Katsura I, Mitani S.
IFT-81 and IFT-74 are required for intraflagellar transport in C. elegans.
Genes Cells 2007 12(5) 593-602 
[ PubMed ID = 17535250 ] [ RRC reference ]