分離済み変異体

tm2348

Allele Nametm2348
BalanceNot Required
OutCrossNot Accepted
Sequence NameF35H12.4
Gene Namepifk-1
Worm BaseAllele Name tm2348
Gene Name pifk-1
Sequence F35H12.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Blacque: dye-filling normal. Dr. M. Chalfie: normal touch sensitivity.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11095/11096-TAAA-11595/11596 (500 bp deletion + 4 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(9443..9627, 10392..10517, 10573..10772, 10828..11054, 11147..11335, 11383..11511, 11615..11845, 11895..12010, 12526..12728, 12776..12893, 12941..13031))
Map position-18.93
Balancer
Map position of balancer
Sequence of primersExtFwd:TCGCTGTCGATCCCACCCAT,IntFwd:GTGACCGTCCATATCCAATA,ExtRev:TTACGGTAAAAGCGCTGGAG,IntRev:GGGCTGCGATCCAGAAAGAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Todd PA, McCue HV, Haynes LP, Barclay JW, Burgoyne RD.
Interaction of ARF-1.1 and neuronal calcium sensor-1 in the control of the temperature-dependency of locomotion in Caenorhabditis elegans.
Sci Rep 2016 6 30023 
[ PubMed ID = 27435667 ] [ RRC reference ]

Kimata T, Tanizawa Y, Can Y, Ikeda S, Kuhara A, Mori I.
Synaptic polarity depends on phosphatidylinositol signaling regulated by myo-inositol monophosphatase in Caenorhabditis elegans.
Genetics 2012 191(2) 509-21 
[ PubMed ID = 22446320 ] [ RRC reference ]