| Allele Name | tm2348 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F35H12.4 |
| Gene Name | pifk-1 |
| Worm Base | Allele Name |
tm2348
|
| Gene Name |
pifk-1
|
| Sequence |
F35H12.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. O. Blacque: dye-filling normal. Dr. M. Chalfie: normal touch sensitivity. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 11095/11096-TAAA-11595/11596 (500 bp deletion + 4 bp insertion) |
| Chromosome | X |
| Putative gene structure | complement(join(9443..9627, 10392..10517, 10573..10772, 10828..11054, 11147..11335, 11383..11511, 11615..11845, 11895..12010, 12526..12728, 12776..12893, 12941..13031)) |
| Map position | -18.93 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TCGCTGTCGATCCCACCCAT,IntFwd:GTGACCGTCCATATCCAATA,ExtRev:TTACGGTAAAAGCGCTGGAG,IntRev:GGGCTGCGATCCAGAAAGAG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Todd PA, McCue HV, Haynes LP, Barclay JW, Burgoyne RD. Interaction of ARF-1.1 and neuronal calcium sensor-1 in the control of the temperature-dependency of locomotion in Caenorhabditis elegans. Sci Rep 2016 6 30023
[ PubMed ID = 27435667 ]
[ RRC reference ]
|
Kimata T, Tanizawa Y, Can Y, Ikeda S, Kuhara A, Mori I. Synaptic polarity depends on phosphatidylinositol signaling regulated by myo-inositol monophosphatase in Caenorhabditis elegans. Genetics 2012 191(2) 509-21
[ PubMed ID = 22446320 ]
[ RRC reference ]
|
|