分離済み変異体

tm2322

Allele Nametm2322
BalanceNot Required
OutCrossNot Accepted
Sequence NameY37E3.5
Gene Namearl-13
Worm BaseAllele Name tm2322
Gene Name arl-13
Sequence Y37E3.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. P. Sengupta: Dyf (some sides normal Dyf, some sides totallyd Dyf, some sides Dydf for few neurons only). Dr. O. Blaque, Dr.K. Oegema, Dr. J. Hu: partial Dyf.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9202/9203-9863/9864 (661 bp deletion)
ChromosomeI
Putative gene structurejoin(6650..6717, 7605..7675, 7736..7872, 8077..8139, 8939..9046, 9146..9211, 9258..9353, 9406..9728, 9779..9950)
Map position-11.96
Balancer
Map position of balancer
Sequence of primersIntRev:GTATCCGGCTATATTGTCGA,ExtRev:GAATCCTTTGTATCCGGCTA,IntFwd:CCACTCCCTAACCAGCAATC,ExtFwd:CCAGGCTCTCCACTCCCTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Turan MG, Kantarci H, Cevik S, Kaplan OI.
ARL13B regulates juxtaposed cilia-cilia elongation in BBSome dependent manner in Caenorhabditis elegans.
iScience 2025 28(2) 111791 
[ PubMed ID = 39925426 ] [ RRC reference ]

Sanders AA, de Vrieze E, Alazami AM, Alzahrani F, Malarkey EB, Sorusch N, Tebbe L, Kuhns S, van Dam TJ, Alhashem A, Tabarki B, Lu Q, Lambacher NJ, Kennedy JE, Bowie RV, Hetterschijt L, van Beersum S, van Reeuwijk J, Boldt K, Kremer H, Kesterson RA, Monies D, Abouelhoda M, Roepman R, Huynen MH, Ueffing M, Russell RB, Wolfrum U, Yoder BK, van Wijk E, Alkuraya FS, Blacque OE.
KIAA0556 is a novel ciliary basal body component mutated in Joubert syndrome.
Genome Biol 2015 16 293 
[ PubMed ID = 26714646 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84 
[ PubMed ID = 24646679 ] [ RRC reference ]

Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P.
Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.
J Cell Sci 2013 126(Pt 19) 4381-95 
[ PubMed ID = 23886944 ] [ RRC reference ]

Cevik S, Sanders AA, Van Wijk E, Boldt K, Clarke L, van Reeuwijk J, Hori Y, Horn N, Hetterschijt L, Wdowicz A, Mullins A, Kida K, Kaplan OI, van Beersum SE, Man Wu K, Letteboer SJ, Mans DA, Katada T, Kontani K, Ueffing M, Roepman R, Kremer H, Blacque OE.
Active transport and diffusion barriers restrict Joubert Syndrome-associated ARL13B/ARL-13 to an Inv-like ciliary membrane subdomain.
PLoS Genet 2013 9(12) e1003977 
[ PubMed ID = 24339792 ] [ RRC reference ]

Kaplan OI, Doroquez DB, Cevik S, Bowie RV, Clarke L, Sanders AA, Kida K, Rappoport JZ, Sengupta P, Blacque OE.
Endocytosis genes facilitate protein and membrane transport in C. elegans sensory cilia.
Curr Biol 2012 22(6) 451-60 
[ PubMed ID = 22342749 ] [ RRC reference ]

Li Y, Wei Q, Zhang Y, Ling K, Hu J.
The small GTPases ARL-13 and ARL-3 coordinate intraflagellar transport and ciliogenesis.
J Cell Biol 2010 189(6) 1039-51 
[ PubMed ID = 20530210 ] [ RRC reference ]

Cevik S, Hori Y, Kaplan OI, Kida K, Toivenon T, Foley-Fisher C, Cottell D, Katada T, Kontani K, Blacque OE.
Joubert syndrome Arl13b functions at ciliary membranes and stabilizes protein transport in Caenorhabditis elegans.
J Cell Biol 2010 188(6) 953-69 
[ PubMed ID = 20231383 ] [ RRC reference ]