Allele Name | tm2320 |
Allele Type | 通常株 |
Sequence Name | T23H2.1 |
Gene Name | npp-12 |
Worm Base | Allele Name |
tm2320
|
Gene Name |
npp-12
|
Sequence |
T23H2.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 13521/13522-13988/13989 (467 bp deletion) |
Chromosome | I |
Putative gene structure | join(10104..10258, 10307..10455, 10498..10862, 10911..11172, 11219..11397, 11464..12747, 12798..13722, 13772..14141, 14217..14373, 14420..14598, 14666..15183, 15233..15561, 15605..15920, 15966..16190, 16239..16369) |
Map position | 1.11 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:CGAATCTGTCCAATGGCATG,ExtRev:CTTACGGAAGCATCGGCATG,IntFwd:CAAGTCTGAGAATGGTACCT,IntRev:GGAAGCATCGGCATGTTGCC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Bahmanyar S, Biggs R, Schuh AL, Desai A, Müller-Reichert T, Audhya A, Dixon JE, Oegema K. Spatial control of phospholipid flux restricts endoplasmic reticulum sheet formation to allow nuclear envelope breakdown. Genes Dev 2014 28(2) 121-6
[ PubMed ID = 24449268 ]
[ RRC reference ]
|
Askjaer P, Galy V, Meister P. Modern tools to study nuclear pore complexes and nucleocytoplasmic transport in Caenorhabditis elegans. Methods Cell Biol 2014 122 277-310
[ PubMed ID = 24857735 ]
[ RRC reference ]
|
Galy V, Antonin W, Jaedicke A, Sachse M, Santarella R, Haselmann U, Mattaj I. A role for gp210 in mitotic nuclear-envelope breakdown. J Cell Sci 2008 121(Pt 3) 317-28
[ PubMed ID = 18216332 ]
[ RRC reference ]
|
|