分離済み変異体

tm2318

Allele Nametm2318
BalanceNot Required
OutCrossNot Accepted
Sequence NameC12C8.1
Gene Namehsp-70
Worm BaseAllele Name tm2318
Gene Name hsp-70
Sequence C12C8.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1846/1847-2047/2048 (201 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(769..1626, 1688..2686, 2764..2838))
Map position3.74
Balancer
Map position of balancer
Sequence of primersIntRev:CCGCTCGTAATCCGGAGAAT,ExtRev:AAGACTACGCCTTCCTACGT,ExtFwd:CCATGACTTAGTGGGACAAC,IntFwd:GTACAGCTGCTTGAACGGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Horikawa M, Fukuyama M, Antebi A, Mizunuma M.
Regulatory mechanism of cold-inducible diapause in Caenorhabditis elegans.
Nat Commun 2024 15(1) 5793 
[ PubMed ID = 38987256 ] [ RRC reference ]

Martin CG, Bent JS, Hill T, Topalidou I, Singhvi A.
Epithelial UNC-23 limits mechanical stress to maintain glia-neuron architecture in C. elegans.
Dev Cell 2024 59(13) 1668-1688.e7 
[ PubMed ID = 38670103 ] [ RRC reference ]

Avila DS, Benedetto A, Au C, Bornhorst J, Aschner M.
Involvement of heat shock proteins on Mn-induced toxicity in Caenorhabditis elegans.
BMC Pharmacol Toxicol 2016 17(1) 54 
[ PubMed ID = 27802836 ] [ RRC reference ]

Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS One 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]

Kourtis N, Nikoletopoulou V, Tavernarakis N.
Small heat-shock proteins protect from heat-stroke-associated neurodegeneration.
Nature 2012 490(7419) 213-8 
[ PubMed ID = 22972192 ] [ RRC reference ]