分離済み変異体

tm2308

Allele Nametm2308
BalanceNot Required
OutCrossNot Accepted
Sequence NameY116F11B.1
Gene Namedaf-28
Worm BaseAllele Name tm2308
Gene Name daf-28
Sequence Y116F11B.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. P. Roy: abnormal muscle arm development. Dr. S. Tuck: Cell 128, 577-587 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 17272/17273-17428/17429 (156 bp deletion)
ChromosomeV
Putative gene structurejoin(17169..17370, 17780..17871)
Map position23.24
Balancer
Map position of balancer
Sequence of primersExtFwd:TCCGCCCACTTTGAGCTATA,ExtRev:GCACCCGATCTGACGACACT,IntFwd:GGGTTATCACTAGGAAGTTG,IntRev:ACCGAGAGGTAGGGGTAATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Le TA, Temmerman L, Roy C.
Nictation behavior in nematodes.
BMC Biol 2025 23(1) 356 
[ PubMed ID = 41350688 ] [ RRC reference ]

Zhang MG, Seyedolmohadesin M, Mercado SH, Tauffenberger A, Park H, Finnen N, Schroeder FC, Venkatachalam V, Sternberg PW.
Sensory integration of food and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(40) e2405391121 
[ PubMed ID = 39316052 ] [ RRC reference ]

Zhang MG, Seyedolmohadesin M, Hawk S, Park H, Finnen N, Schroeder F, Venkatachalam V, Sternberg PW.
Sensory integration of food availability and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans.
bioRxiv 2024   
[ PubMed ID = 38586049 ] [ RRC reference ]

Mishra S, Dabaja M, Akhlaq A, Pereira B, Marbach K, Rovcanin M, Chandra R, Caballero A, Fernandes de Abreu D, Ch'ng Q, Alcedo J.
Specific sensory neurons and insulin-like peptides modulate food type-dependent oogenesis and fertilization in Caenorhabditis elegans.
Elife 2023 12  
[ PubMed ID = 37975568 ] [ RRC reference ]

Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, Bülow HE, Henis-Korenblit S.
Correction: It's All in Your Mind: Determining Germ Cell Fate by Neuronal IRE-1 in C. elegans.
PLoS Genet 2023 19(11) e1011061 
[ PubMed ID = 38032985 ] [ RRC reference ]

Podraza-Farhanieh A, Raj D, Kao G, Naredi P.
A proinsulin-dependent interaction between ENPL-1 and ASNA-1 in neurons is required to maintain insulin secretion in C. elegans.
Development 2023 150(6)  
[ PubMed ID = 36939052 ] [ RRC reference ]

Schiffer JA, Servello FA, Heath WR, Amrit FRG, Stumbur SV, Eder M, Martin OM, Johnsen SB, Stanley JA, Tam H, Brennan SJ, McGowan NG, Vogelaar AL, Xu Y, Serkin WT, Ghazi A, Stroustrup N, Apfeld J.
Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies.
Elife 2020 9  
[ PubMed ID = 32367802 ] [ RRC reference ]

Horowitz LB, Brandt JP, Ringstad N.
Repression of an activity-dependent autocrine insulin signal is required for sensory neuron development in C. elegans.
Development 2019 146(22)  
[ PubMed ID = 31628111 ] [ RRC reference ]

Kaplan REW, Maxwell CS, Codd NK, Baugh LR.
Pervasive Positive and Negative Feedback Regulation of Insulin-Like Signaling in Caenorhabditis elegans.
Genetics 2019 211(1) 349-361 
[ PubMed ID = 30425043 ] [ RRC reference ]

Kaplan REW, Webster AK, Chitrakar R, Dent JA, Baugh LR.
Food perception without ingestion leads to metabolic changes and irreversible developmental arrest in C. elegans.
BMC Biol 2018 16(1) 112 
[ PubMed ID = 30296941 ] [ RRC reference ]

Ryu L, Cheon Y, Huh YH, Pyo S, Chinta S, Choi H, Butcher RA, Kim K.
Feeding state regulates pheromone-mediated avoidance behavior via the insulin signaling pathway in Caenorhabditis elegans.
EMBO J 2018 37(15)  
[ PubMed ID = 29925517 ] [ RRC reference ]

Park S, Paik YK.
Genetic deficiency in neuronal peroxisomal fatty acid β-oxidation causes the interruption of dauer development in Caenorhabditis elegans.
Sci Rep 2017 7(1) 9358 
[ PubMed ID = 28839231 ] [ RRC reference ]

Kulalert W, Sadeeshkumar H, Zhang YK, Schroeder FC, Kim DH.
Molecular Determinants of the Regulation of Development and Metabolism by Neuronal eIF2α Phosphorylation in Caenorhabditis elegans.
Genetics 2017 206(1) 251-263 
[ PubMed ID = 28292919 ] [ RRC reference ]

Klabonski L, Zha J, Senthilkumar L, Gidalevitz T.
A Bystander Mechanism Explains the Specific Phenotype of a Broadly Expressed Misfolded Protein.
PLoS Genet 2016 12(12) e1006450 
[ PubMed ID = 27926939 ] [ RRC reference ]

Greene JS, Dobosiewicz M, Butcher RA, McGrath PT, Bargmann CI.
Regulatory changes in two chemoreceptor genes contribute to a Caenorhabditis elegans QTL for foraging behavior.
Elife 2016 5  
[ PubMed ID = 27893361 ] [ RRC reference ]

Gruner M, Grubbs J, McDonagh A, Valdes D, Winbush A, van der Linden AM.
Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors.
PLoS Genet 2016 12(8) e1006237 
[ PubMed ID = 27487365 ] [ RRC reference ]

Reis Rodrigues P, Kaul TK, Ho JH, Lucanic M, Burkewitz K, Mair WB, Held JM, Bohn LM, Gill MS.
Synthetic Ligands of Cannabinoid Receptors Affect Dauer Formation in the Nematode Caenorhabditis elegans.
G3 (Bethesda) 2016 6(6) 1695-705 
[ PubMed ID = 27172180 ] [ RRC reference ]

Matsunaga Y, Honda Y, Honda S, Iwasaki T, Qadota H, Benian GM, Kawano T.
Diapause is associated with a change in the polarity of secretion of insulin-like peptides.
Nat Commun 2016 7 10573 
[ PubMed ID = 26838180 ] [ RRC reference ]

Kaplan RE, Chen Y, Moore BT, Jordan JM, Maxwell CS, Schindler AJ, Baugh LR.
dbl-1/TGF-β and daf-12/NHR Signaling Mediate Cell-Nonautonomous Effects of daf-16/FOXO on Starvation-Induced Developmental Arrest.
PLoS Genet 2015 11(12) e1005731 
[ PubMed ID = 26656736 ] [ RRC reference ]

Fukuyama M, Kontani K, Katada T, Rougvie AE.
The C. elegans Hypodermis Couples Progenitor Cell Quiescence to the Dietary State.
Curr Biol 2015 25(9) 1241-8 
[ PubMed ID = 25891400 ] [ RRC reference ]