分離済み変異体

tm2304

Allele Nametm2304
BalanceNot Required
OutCrossNot Accepted
Sequence NameT13C2.4
Gene Namessup-72
Worm BaseAllele Name tm2304
Gene Name ssup-72
Sequence T13C2.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10202/10203-10633/10634 (431 bp deletion)
ChromosomeII
Putative gene structurejoin(9571..9683, 10105..10188, 10233..10379, 10451..10580, 10629..10862)
Map position0.1
Balancer
Map position of balancer
Sequence of primersExtRev:CTCTTCGAGGTCGGTGATTA,IntFwd:GCGTACTCCTCTCGGACGAT,ExtFwd:ACATTCCATGCGGCGGCCTA,IntRev:CGCAGAGATCAGCTACGAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Stubbe FX, Ponsard P, Steiner FA, Hermand D.
SSUP-72/PINN-1 coordinates RNA-polymerase II 3' pausing and developmental gene expression in C. elegans.
Nat Commun 2025 16(1) 2624 
[ PubMed ID = 40097442 ] [ RRC reference ]

Chen F, Chisholm AD, Jin Y.
Tissue-specific regulation of alternative polyadenylation represses expression of a neuronal ankyrin isoform in C. elegans epidermal development.
Development 2017 144(4) 698-707 
[ PubMed ID = 28087624 ] [ RRC reference ]

Chen F, Zhou Y, Qi YB, Khivansara V, Li H, Chun SY, Kim JK, Fu XD, Jin Y.
Context-dependent modulation of Pol II CTD phosphatase SSUP-72 regulates alternative polyadenylation in neuronal development.
Genes Dev 2015 29(22) 2377-90 
[ PubMed ID = 26588990 ] [ RRC reference ]