Allele Name | tm2304 |
Allele Type | 通常株 |
Sequence Name | T13C2.4 |
Gene Name | ssup-72 |
Worm Base | Allele Name |
tm2304
|
Gene Name |
ssup-72
|
Sequence |
T13C2.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 10202/10203-10633/10634 (431 bp deletion) |
Chromosome | II |
Putative gene structure | join(9571..9683, 10105..10188, 10233..10379, 10451..10580, 10629..10862) |
Map position | 0.1 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:CTCTTCGAGGTCGGTGATTA,IntFwd:GCGTACTCCTCTCGGACGAT,ExtFwd:ACATTCCATGCGGCGGCCTA,IntRev:CGCAGAGATCAGCTACGAAG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Chen F, Chisholm AD, Jin Y. Tissue-specific regulation of alternative polyadenylation represses expression of a neuronal ankyrin isoform in C. elegans epidermal development. Development 2017 144(4) 698-707
[ PubMed ID = 28087624 ]
[ RRC reference ]
|
Chen F, Zhou Y, Qi YB, Khivansara V, Li H, Chun SY, Kim JK, Fu XD, Jin Y. Context-dependent modulation of Pol II CTD phosphatase SSUP-72 regulates alternative polyadenylation in neuronal development. Genes Dev 2015 29(22) 2377-90
[ PubMed ID = 26588990 ]
[ RRC reference ]
|
|