| Allele Name | tm2299 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | C07G1.4 |
| Gene Name | wsp-1 |
| Worm Base | Allele Name |
tm2299
(x1) |
| Gene Name |
wsp-1
|
| Sequence |
C07G1.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 21155/21156-21336/21337 (181 bp deletion) |
| Chromosome | IV |
| Putative gene structure | complement(join(19388..19478, 19575..19741, 19797..19919, 19965..20228, 20277..20472, 20926..21195, 21244..21352, 21590..21736, 22312..23408, 27903..28018, 28496..28825)) |
| Map position | 3.66 |
| Balancer | nT1 |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TGTATCTTCACAGGGGCGAA,ExtRev:CGGATCCACTCCAACACGAC,IntRev:ATTGGCGGAGGTCAAGGGAT,IntFwd:ACAGGGGCGAAACCCAGTAG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Shi X, Duan F, Lin L, Xu Q, Xu T, Zhang R.
WIP-1 and DBN-1 promote scission of endocytic vesicles by bridging actin and Dynamin-1 in the C. elegans intestine.
J Cell Sci 2019 132(12)
[ PubMed ID = 31118234 ]
[ RRC reference ]
|
Alan JK, Struckhoff EC, Lundquist EA.
Multiple cytoskeletal pathways and PI3K signaling mediate CDC-42-induced neuronal protrusion in C. elegans.
Small GTPases 2013 4(4) 208-20
[ PubMed ID = 24149939 ]
[ RRC reference ]
|
Mohamed AM, Boudreau JR, Yu FP, Liu J, Chin-Sang ID.
The Caenorhabditis elegans Eph receptor activates NCK and N-WASP, and inhibits Ena/VASP to regulate growth cone dynamics during axon guidance.
PLoS Genet 2012 8(2) e1002513
[ PubMed ID = 22383893 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.