| Allele Name | tm2285 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | F35H10.6 |
| Gene Name | F35H10.6 |
| Worm Base | Allele Name |
tm2285
(x1) |
| Gene Name |
F35H10.6
|
| Sequence |
F35H10.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 4108/4109-AAATTATTTTTATAATATTTTTATAAAA-4580/4581 (472 bp deletion + 28 bp insertion) |
| Chromosome | IV |
| Putative gene structure | join(4024..4075, 4140..4203, 4252..4357, 4400..4467, 4512..4755) |
| Map position | 3.71 |
| Balancer | nT1 [qIs51] |
| Map position of balancer | |
| Sequence of primers | ExtRev:CGTAGGGAAATGTGGATGAG,IntRev:CACATATGGCATATCCATCG,ExtFwd:CTACATTCCGCCGTCCTGAT,IntFwd:GTTGCCGAGTAGCCAAGGAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mishur RJ, Khan M, Munkácsy E, Sharma L, Bokov A, Beam H, Radetskaya O, Borror M, Lane R, Bai Y, Rea SL. Mitochondrial metabolites extend lifespan. Aging Cell 2016 15(2) 336-48
[ PubMed ID = 26729005 ]
[ RRC reference ]
|
Butler JA, Mishur RJ, Bhaskaran S, Rea SL. A metabolic signature for long life in the Caenorhabditis elegans Mit mutants. Aging Cell 2013 12(1) 130-8
[ PubMed ID = 23173729 ]
[ RRC reference ]
|
|