Allele Name | tm2260 |
Allele Type | 通常株 |
Sequence Name | Y47H9C.6 |
Gene Name | csp-3 |
Worm Base | Allele Name |
tm2260
|
Gene Name |
csp-3
|
Sequence |
Y47H9C.6
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 57898/57899-58091/58092 (193 bp deletion) |
Chromosome | I |
Putative gene structure | complement(join(58017..58073, 58116..58352, 58397..58522)) |
Map position | 12.87 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:GCTAGCATGACATCGTCACA,IntFwd:ATTCATCGTAGCAGCGGGAA,ExtRev:CGCCTCAAACGCCACTGGAT,IntRev:CGCCACTGGATTCTCTGGTA |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Jeong PY, Kumar A, Joshi PM, Rothman JH. Intertwined Functions of Separase and Caspase in Cell Division and Programmed Cell Death. Sci Rep 2020 10(1) 6159
[ PubMed ID = 32273538 ]
[ RRC reference ]
|
Geng X, Zhou QH, Kage-Nakadai E, Shi Y, Yan N, Mitani S, Xue D. Caenorhabditis elegans caspase homolog CSP-2 inhibits CED-3 autoactivation and apoptosis in germ cells. Cell Death Differ 2009 16(10) 1385-94
[ PubMed ID = 19575016 ]
[ RRC reference ]
|
Geng X, Shi Y, Nakagawa A, Yoshina S, Mitani S, Shi Y, Xue D. Inhibition of CED-3 zymogen activation and apoptosis in Caenorhabditis elegans by caspase homolog CSP-3. Nat Struct Mol Biol 2008 15(10) 1094-101
[ PubMed ID = 18776901 ]
[ RRC reference ]
|
|